Mutagenetix > Incidental Mutations

Incidental Mutation 'R5605:Spef2'

439263

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

MMRRC Submission

043270-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R5605 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9578193-9748868 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9609520 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1306 (N1306K)

Ref Sequence

ENSEMBL: ENSMUSP00000146967 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160236] [ENSMUST00000208854]

Predicted Effect

probably benign
Transcript: ENSMUST00000160236
AA Change: N1306K

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: N1306K

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000208854
AA Change: N1306K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

Meta Mutation Damage Score

0.0903

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg3l2	C	A	18: 67,442,355	G83*	probably null	Het
Arap2	A	T	5: 62,615,067	M1476K	possibly damaging	Het
Catsper2	G	A	2: 121,397,052	R546C	possibly damaging	Het
Ccdc109b	T	C	3: 129,917,009	E258G	probably damaging	Het
Ceacam5	T	C	7: 17,747,236	F303L	probably benign	Het
Clvs1	A	G	4: 9,281,751	D65G	probably damaging	Het
Coq5	T	C	5: 115,283,717		probably null	Het
D630045J12Rik	A	T	6: 38,191,764	V950E	probably damaging	Het
Dennd4b	G	A	3: 90,268,368	R148Q	probably damaging	Het
Dnah7c	A	G	1: 46,798,235	D3936G	possibly damaging	Het
Doc2b	T	C	11: 75,771,960	E404G	probably damaging	Het
Dsg1b	C	T	18: 20,399,539	P547S	probably benign	Het
Erich6	A	G	3: 58,625,119	Y356H	probably damaging	Het
Galnt6	C	T	15: 100,697,225	R465Q	probably damaging	Het
Gbp5	T	C	3: 142,501,276	S69P	probably damaging	Het
Gdpd4	T	C	7: 98,006,300	V562A	probably benign	Het
Gm2075	T	A	12: 88,011,998	C51S	probably damaging	Het
Gm340	T	A	19: 41,582,863	I165N	probably damaging	Het
Greb1	A	T	12: 16,708,726	V663D	probably damaging	Het
Gtf3c3	A	T	1: 54,415,926	S593T	probably benign	Het
H2-Eb1	T	C	17: 34,309,833	S113P	probably benign	Het
Herc3	C	T	6: 58,857,727	R240C	probably damaging	Het
Iqub	T	C	6: 24,505,621	D96G	probably benign	Het
Kcnt2	A	T	1: 140,574,743	E858D	possibly damaging	Het
Lrp2	C	T	2: 69,523,299	R539K	probably damaging	Het
Lrrc10	C	A	10: 117,045,900	P160T	probably damaging	Het
Map3k12	G	T	15: 102,503,865	D280E	probably benign	Het
Mdn1	T	C	4: 32,765,664	S5208P	probably benign	Het
Med20	C	A	17: 47,623,144		probably benign	Het
Mertk	T	C	2: 128,738,307	V227A	probably benign	Het
Mrvi1	C	T	7: 110,946,002	C29Y	possibly damaging	Het
Ncstn	A	G	1: 172,081,150		probably benign	Het
Nedd4l	T	C	18: 65,174,244		probably null	Het
Nfyc	A	G	4: 120,790,489		probably benign	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Nt5dc1	C	T	10: 34,403,695	C117Y	probably benign	Het
Nup88	A	T	11: 70,944,070		probably benign	Het
Olfr5	C	T	7: 6,480,326	V277M	probably benign	Het
Pbrm1	T	A	14: 31,035,992	I193K	probably benign	Het
Pcsk2	T	C	2: 143,749,245		probably benign	Het
Pdzd2	A	T	15: 12,592,350	C69*	probably null	Het
Polr1e	A	G	4: 45,018,723	T18A	probably benign	Het
Prima1	T	A	12: 103,199,904	I124F	probably benign	Het
Rbm34	T	C	8: 126,949,419	K382R	probably benign	Het
Rftn1	T	G	17: 50,047,407	N309T	probably damaging	Het
Sept1	C	T	7: 127,215,426	D260N	probably damaging	Het
Serpina3g	T	C	12: 104,241,040	V154A	probably damaging	Het
Stk4	T	C	2: 164,079,566	F29S	probably damaging	Het
Stxbp5	A	G	10: 9,769,746		probably benign	Het
Tbl3	T	C	17: 24,700,759	T774A	probably benign	Het
Tinag	A	G	9: 77,045,412	Y97H	probably damaging	Het
Tpm1	T	C	9: 67,049,035	E33G	probably damaging	Het
Usp17lb	T	C	7: 104,840,640	E359G	probably benign	Het
Vmn2r91	A	G	17: 18,136,501	E810G	probably damaging	Het
Vwce	A	T	19: 10,658,038	T633S	possibly damaging	Het
Ylpm1	G	A	12: 85,028,853	R326H	probably damaging	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9740535	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9663095	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9716413	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9676290	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9663158	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9704380	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9717576	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9717498	nonsense	probably null
IGL02605:Spef2	APN	15	9725152	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9748767	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9679346	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9668874	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9713243	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9725106	splice site	probably benign
IGL03263:Spef2	APN	15	9667219	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9676380	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0183:Spef2	UTSW	15	9716359	missense	possibly damaging	0.70
R0386:Spef2	UTSW	15	9584062	missense	probably damaging	1.00
R0511:Spef2	UTSW	15	9583984	critical splice donor site	probably null
R0617:Spef2	UTSW	15	9592758	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9626131	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9687813	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9614195	splice site	probably null
R0939:Spef2	UTSW	15	9704550	splice site	probably null
R0973:Spef2	UTSW	15	9716396	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9725108	splice site	probably benign
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1428:Spef2	UTSW	15	9596707	unclassified	probably benign
R1518:Spef2	UTSW	15	9667230	missense	probably damaging	1.00
R1585:Spef2	UTSW	15	9596574	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9634652	missense	probably damaging	0.99
R1723:Spef2	UTSW	15	9614209	missense	probably damaging	1.00
R1757:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9679349	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9597401	missense	possibly damaging	0.78
R1897:Spef2	UTSW	15	9729654	nonsense	probably null
R1901:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9663194	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9609516	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9663066	makesense	probably null
R1998:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9713185	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9589573	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9626034	nonsense	probably null
R2517:Spef2	UTSW	15	9725197	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9630613	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9682623	missense	probably benign	0.43
R3792:Spef2	UTSW	15	9704536	missense	probably damaging	1.00
R4154:Spef2	UTSW	15	9626021	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9676321	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9667280	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4321:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9647217	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9647438	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9676373	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9647490	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9652954	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9713178	nonsense	probably null
R5004:Spef2	UTSW	15	9578327	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9668791	nonsense	probably null
R5230:Spef2	UTSW	15	9667230	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9596691	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9614281	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9583836	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9729703	missense	possibly damaging	0.53
R5787:Spef2	UTSW	15	9748726	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9614215	missense	probably benign	0.16
R6177:Spef2	UTSW	15	9727532	missense	possibly damaging	0.89
R6641:Spef2	UTSW	15	9625973	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9600518	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9592749	missense	probably damaging	1.00
R6956:Spef2	UTSW	15	9684935	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9597340	missense	probably benign	0.02
R7089:Spef2	UTSW	15	9725171	missense	probably damaging	1.00
R7117:Spef2	UTSW	15	9729838	missense	probably damaging	1.00
R7161:Spef2	UTSW	15	9717603	missense	probably benign	0.29
R7223:Spef2	UTSW	15	9601640	missense	unknown
R7263:Spef2	UTSW	15	9653012	splice site	probably null
R7270:Spef2	UTSW	15	9599980	critical splice donor site	probably null
R7303:Spef2	UTSW	15	9647490	missense	possibly damaging	0.92
R7369:Spef2	UTSW	15	9584207	missense	probably benign	0.02
R7464:Spef2	UTSW	15	9740585	missense	probably benign	0.23
R7498:Spef2	UTSW	15	9727539	missense	probably benign
R7587:Spef2	UTSW	15	9713219	missense	probably damaging	1.00
R7748:Spef2	UTSW	15	9652945	missense	probably damaging	0.98
R7772:Spef2	UTSW	15	9704481	missense	probably damaging	0.99
R7838:Spef2	UTSW	15	9609551	missense	possibly damaging	0.53
R7854:Spef2	UTSW	15	9596644	missense	possibly damaging	0.77
R7855:Spef2	UTSW	15	9687895	missense	possibly damaging	0.53
R7889:Spef2	UTSW	15	9717563	missense	probably damaging	1.00
R7943:Spef2	UTSW	15	9601085	missense	unknown
R8105:Spef2	UTSW	15	9682662	missense	probably benign	0.06
R8151:Spef2	UTSW	15	9601512	missense	unknown
R8296:Spef2	UTSW	15	9727543	missense	probably benign	0.06
R8393:Spef2	UTSW	15	9676529	missense	probably benign	0.27
R8405:Spef2	UTSW	15	9612557	missense	probably benign	0.00
R8552:Spef2	UTSW	15	9600679	intron	probably benign
X0025:Spef2	UTSW	15	9596622	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCATAACAGGTGCGGGTGG -3'
(R):5'- CTGTGTTCCTGTATCTGCAAAATAC -3'

Sequencing Primer
(F):5'- CACAGAGATACACAGAGACACATGTG -3'
(R):5'- CCTGTATCTGCAAAATACAAATGC -3'

Posted On

2016-10-26