Incidental Mutation 'R5605:Map3k12'
ID439266
Institutional Source Beutler Lab
Gene Symbol Map3k12
Ensembl Gene ENSMUSG00000023050
Gene Namemitogen-activated protein kinase kinase kinase 12
SynonymsMUK, DLK, Zpk
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5605 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102497646-102517064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102503865 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 280 (D280E)
Ref Sequence ENSEMBL: ENSMUSP00000127629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023812] [ENSMUST00000077037] [ENSMUST00000078404] [ENSMUST00000096145] [ENSMUST00000108838] [ENSMUST00000165174] [ENSMUST00000169162] [ENSMUST00000169367] [ENSMUST00000169377] [ENSMUST00000171565] [ENSMUST00000229618] [ENSMUST00000229854]
Predicted Effect probably benign
Transcript: ENSMUST00000023812
AA Change: D280E

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023812
Gene: ENSMUSG00000023050
AA Change: D280E

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077037
SMART Domains Protein: ENSMUSP00000076294
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 283 353 5.19e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078404
SMART Domains Protein: ENSMUSP00000077509
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 270 340 5.19e-15 SMART
Predicted Effect silent
Transcript: ENSMUST00000096145
SMART Domains Protein: ENSMUSP00000093859
Gene: ENSMUSG00000071586

DomainStartEndE-ValueType
low complexity region 29 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108838
SMART Domains Protein: ENSMUSP00000104466
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 252 322 5.19e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164343
Predicted Effect probably benign
Transcript: ENSMUST00000165174
Predicted Effect probably benign
Transcript: ENSMUST00000169162
Predicted Effect probably benign
Transcript: ENSMUST00000169367
Predicted Effect probably benign
Transcript: ENSMUST00000169377
AA Change: D280E

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133209
Gene: ENSMUSG00000023050
AA Change: D280E

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 159 397 1.2e-58 PFAM
Pfam:Pkinase_Tyr 160 397 3.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171565
AA Change: D280E

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127629
Gene: ENSMUSG00000023050
AA Change: D280E

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229822
Predicted Effect probably benign
Transcript: ENSMUST00000229854
Meta Mutation Damage Score 0.2458 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. This kinase contains a leucine-zipper domain and is predominately expressed in neuronal cells. The phosphorylation state of this kinase in synaptic terminals was shown to be regulated by membrane depolarization via calcineurin. This kinase forms heterodimers with leucine zipper containing transcription factors, such as cAMP responsive element binding protein (CREB) and MYC, and thus may play a regulatory role in PKA or retinoic acid induced neuronal differentiation. Alternatively spliced transcript variants encoding different proteins have been described.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a gene-trapped allele lack the brain anterior commissure. Mice homozygous for a knock-out allele exhibit postnatal lethality and abnormal axon growth and radial migration of neocortical pyramidal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gbp5 T C 3: 142,501,276 S69P probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
H2-Eb1 T C 17: 34,309,833 S113P probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Med20 C A 17: 47,623,144 probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Mrvi1 C T 7: 110,946,002 C29Y possibly damaging Het
Ncstn A G 1: 172,081,150 probably benign Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Olfr5 C T 7: 6,480,326 V277M probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rbm34 T C 8: 126,949,419 K382R probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Sept1 C T 7: 127,215,426 D260N probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tinag A G 9: 77,045,412 Y97H probably damaging Het
Tpm1 T C 9: 67,049,035 E33G probably damaging Het
Usp17lb T C 7: 104,840,640 E359G probably benign Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Ylpm1 G A 12: 85,028,853 R326H probably damaging Het
Other mutations in Map3k12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Map3k12 APN 15 102503751 missense probably damaging 1.00
IGL01713:Map3k12 APN 15 102502321 missense probably damaging 1.00
IGL01720:Map3k12 APN 15 102502186 unclassified probably benign
IGL02262:Map3k12 APN 15 102502075 missense probably damaging 1.00
IGL02670:Map3k12 APN 15 102503546 missense probably benign 0.09
IGL03004:Map3k12 APN 15 102504196 missense possibly damaging 0.96
IGL03369:Map3k12 APN 15 102502079 missense possibly damaging 0.47
react UTSW 15 102505402 missense probably damaging 1.00
R0894:Map3k12 UTSW 15 102502178 missense probably damaging 1.00
R0918:Map3k12 UTSW 15 102503852 missense probably damaging 0.99
R1547:Map3k12 UTSW 15 102503852 missense probably damaging 1.00
R1844:Map3k12 UTSW 15 102503535 missense probably damaging 1.00
R1880:Map3k12 UTSW 15 102502064 critical splice donor site probably null
R2292:Map3k12 UTSW 15 102500139 missense probably damaging 0.96
R4397:Map3k12 UTSW 15 102501259 missense probably benign 0.44
R4406:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4407:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4408:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4731:Map3k12 UTSW 15 102501282 missense probably benign 0.28
R5074:Map3k12 UTSW 15 102501832 critical splice donor site probably null
R5848:Map3k12 UTSW 15 102504235 missense possibly damaging 0.66
R6232:Map3k12 UTSW 15 102503646 missense probably damaging 0.99
R6901:Map3k12 UTSW 15 102500629 missense possibly damaging 0.95
R6901:Map3k12 UTSW 15 102500630 missense possibly damaging 0.65
R6946:Map3k12 UTSW 15 102505134 missense possibly damaging 0.89
R7291:Map3k12 UTSW 15 102502166 missense probably damaging 1.00
R7874:Map3k12 UTSW 15 102500642 missense possibly damaging 0.91
R7957:Map3k12 UTSW 15 102500642 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACCTGCATGACCTCTGTACC -3'
(R):5'- CTGATGTGCGTGTAGGTCAC -3'

Sequencing Primer
(F):5'- GCATGACCTCTGTACCTGTCTCATC -3'
(R):5'- AGCCTGGCCAACTCCCTATG -3'
Posted On2016-10-26