Incidental Mutation 'R5605:H2-Eb1'
ID439268
Institutional Source Beutler Lab
Gene Symbol H2-Eb1
Ensembl Gene ENSMUSG00000060586
Gene Namehistocompatibility 2, class II antigen E beta
SynonymsH-2Eb, Ia-4, Ia4
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5605 (G1)
Quality Score187
Status Validated
Chromosome17
Chromosomal Location34305877-34316199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34309833 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 113 (S113P)
Ref Sequence ENSEMBL: ENSMUSP00000074143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074557]
Predicted Effect probably benign
Transcript: ENSMUST00000074557
AA Change: S113P

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000074143
Gene: ENSMUSG00000060586
AA Change: S113P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_beta 40 114 4.64e-47 SMART
IGc1 139 210 2.24e-24 SMART
transmembrane domain 226 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174074
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DRB5 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. The presence of DRB5 is linked with allelic variants of DRB1, otherwise it is omitted. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gbp5 T C 3: 142,501,276 S69P probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Map3k12 G T 15: 102,503,865 D280E probably benign Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Med20 C A 17: 47,623,144 probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Mrvi1 C T 7: 110,946,002 C29Y possibly damaging Het
Ncstn A G 1: 172,081,150 probably benign Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Olfr5 C T 7: 6,480,326 V277M probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rbm34 T C 8: 126,949,419 K382R probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Sept1 C T 7: 127,215,426 D260N probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tinag A G 9: 77,045,412 Y97H probably damaging Het
Tpm1 T C 9: 67,049,035 E33G probably damaging Het
Usp17lb T C 7: 104,840,640 E359G probably benign Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Ylpm1 G A 12: 85,028,853 R326H probably damaging Het
Other mutations in H2-Eb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0724:H2-Eb1 UTSW 17 34315032 splice site probably benign
R0763:H2-Eb1 UTSW 17 34314159 splice site probably benign
R2029:H2-Eb1 UTSW 17 34314392 missense probably damaging 1.00
R3155:H2-Eb1 UTSW 17 34314374 missense probably damaging 0.98
R3440:H2-Eb1 UTSW 17 34309681 missense probably damaging 1.00
R4050:H2-Eb1 UTSW 17 34314368 missense probably damaging 1.00
R4084:H2-Eb1 UTSW 17 34314443 missense probably damaging 0.98
R5667:H2-Eb1 UTSW 17 34314255 nonsense probably null
R5671:H2-Eb1 UTSW 17 34314255 nonsense probably null
R5851:H2-Eb1 UTSW 17 34309771 missense probably benign 0.13
R6951:H2-Eb1 UTSW 17 34309857 nonsense probably null
R7387:H2-Eb1 UTSW 17 34314233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCTTCTGGAAAGATACTTCTAC -3'
(R):5'- TCAGCAGTTAATGGTACCAAGG -3'

Sequencing Primer
(F):5'- CTGGAAAGATACTTCTACAACCTGG -3'
(R):5'- AATTCCGTTCCCCTGCCAAGAG -3'
Posted On2016-10-26