Incidental Mutation 'R5605:Med20'
ID439269
Institutional Source Beutler Lab
Gene Symbol Med20
Ensembl Gene ENSMUSG00000092558
Gene Namemediator complex subunit 20
SynonymsTrfp, 1110011O05Rik, 2410115I17Rik
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5605 (G1)
Quality Score178
Status Validated
Chromosome17
Chromosomal Location47611582-47624418 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 47623144 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024778] [ENSMUST00000132397]
Predicted Effect probably benign
Transcript: ENSMUST00000024778
SMART Domains Protein: ENSMUSP00000024778
Gene: ENSMUSG00000092558

DomainStartEndE-ValueType
Pfam:Med20 1 198 6.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130830
Predicted Effect probably benign
Transcript: ENSMUST00000132397
SMART Domains Protein: ENSMUSP00000117658
Gene: ENSMUSG00000023984

DomainStartEndE-ValueType
Pfam:Med20 1 149 1.6e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149893
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. A mutation in this gene has been associated with a novel infantile-onset neurodegenerative movement disorder. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gbp5 T C 3: 142,501,276 S69P probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
H2-Eb1 T C 17: 34,309,833 S113P probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Map3k12 G T 15: 102,503,865 D280E probably benign Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Mrvi1 C T 7: 110,946,002 C29Y possibly damaging Het
Ncstn A G 1: 172,081,150 probably benign Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Olfr5 C T 7: 6,480,326 V277M probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rbm34 T C 8: 126,949,419 K382R probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Sept1 C T 7: 127,215,426 D260N probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tinag A G 9: 77,045,412 Y97H probably damaging Het
Tpm1 T C 9: 67,049,035 E33G probably damaging Het
Usp17lb T C 7: 104,840,640 E359G probably benign Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Ylpm1 G A 12: 85,028,853 R326H probably damaging Het
Other mutations in Med20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Med20 APN 17 47623000 missense possibly damaging 0.92
R0847:Med20 UTSW 17 47611693 critical splice donor site probably null
R0881:Med20 UTSW 17 47611680 start codon destroyed probably null 1.00
R4460:Med20 UTSW 17 47618917 missense probably benign 0.39
R4461:Med20 UTSW 17 47618917 missense probably benign 0.39
R5212:Med20 UTSW 17 47618850 missense probably benign 0.02
V7580:Med20 UTSW 17 47618832 missense probably damaging 1.00
V7582:Med20 UTSW 17 47618832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCCACAGTATTTGGGAAC -3'
(R):5'- TAACCATCTCCAGGAGAGGC -3'

Sequencing Primer
(F):5'- CAGACACGATGCGGTCTATG -3'
(R):5'- CGCATCCTCAAGCGAAGG -3'
Posted On2016-10-26