Incidental Mutation 'R5605:Nedd4l'
ID 439272
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 043270-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R5605 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 65307315 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000080418
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163516
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably null
Transcript: ENSMUST00000224347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224890
Predicted Effect probably null
Transcript: ENSMUST00000226058
Meta Mutation Damage Score 0.9501 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,575,425 (GRCm39) G83* probably null Het
Arap2 A T 5: 62,772,410 (GRCm39) M1476K possibly damaging Het
Catsper2 G A 2: 121,227,533 (GRCm39) R546C possibly damaging Het
Ceacam5 T C 7: 17,481,161 (GRCm39) F303L probably benign Het
Clvs1 A G 4: 9,281,751 (GRCm39) D65G probably damaging Het
Coq5 T C 5: 115,421,776 (GRCm39) probably null Het
D630045J12Rik A T 6: 38,168,699 (GRCm39) V950E probably damaging Het
Dennd4b G A 3: 90,175,675 (GRCm39) R148Q probably damaging Het
Dnah7c A G 1: 46,837,395 (GRCm39) D3936G possibly damaging Het
Doc2b T C 11: 75,662,786 (GRCm39) E404G probably damaging Het
Dsg1b C T 18: 20,532,596 (GRCm39) P547S probably benign Het
Eif1ad17 T A 12: 87,978,768 (GRCm39) C51S probably damaging Het
Erich6 A G 3: 58,532,540 (GRCm39) Y356H probably damaging Het
Galnt6 C T 15: 100,595,106 (GRCm39) R465Q probably damaging Het
Gbp5 T C 3: 142,207,037 (GRCm39) S69P probably damaging Het
Gdpd4 T C 7: 97,655,507 (GRCm39) V562A probably benign Het
Greb1 A T 12: 16,758,727 (GRCm39) V663D probably damaging Het
Gtf3c3 A T 1: 54,455,085 (GRCm39) S593T probably benign Het
H2-Eb1 T C 17: 34,528,807 (GRCm39) S113P probably benign Het
Herc3 C T 6: 58,834,712 (GRCm39) R240C probably damaging Het
Iqub T C 6: 24,505,620 (GRCm39) D96G probably benign Het
Irag1 C T 7: 110,545,209 (GRCm39) C29Y possibly damaging Het
Kcnt2 A T 1: 140,502,481 (GRCm39) E858D possibly damaging Het
Lcor T A 19: 41,571,302 (GRCm39) I165N probably damaging Het
Lrp2 C T 2: 69,353,643 (GRCm39) R539K probably damaging Het
Lrrc10 C A 10: 116,881,805 (GRCm39) P160T probably damaging Het
Map3k12 G T 15: 102,412,300 (GRCm39) D280E probably benign Het
Mcub T C 3: 129,710,658 (GRCm39) E258G probably damaging Het
Mdn1 T C 4: 32,765,664 (GRCm39) S5208P probably benign Het
Med20 C A 17: 47,934,069 (GRCm39) probably benign Het
Mertk T C 2: 128,580,227 (GRCm39) V227A probably benign Het
Ncstn A G 1: 171,908,717 (GRCm39) probably benign Het
Nfyc A G 4: 120,647,686 (GRCm39) probably benign Het
Npdc1 G A 2: 25,298,957 (GRCm39) D284N probably damaging Het
Nt5dc1 C T 10: 34,279,691 (GRCm39) C117Y probably benign Het
Nup88 A T 11: 70,834,896 (GRCm39) probably benign Het
Or6z7 C T 7: 6,483,325 (GRCm39) V277M probably benign Het
Pbrm1 T A 14: 30,757,949 (GRCm39) I193K probably benign Het
Pcsk2 T C 2: 143,591,165 (GRCm39) probably benign Het
Pdzd2 A T 15: 12,592,436 (GRCm39) C69* probably null Het
Polr1e A G 4: 45,018,723 (GRCm39) T18A probably benign Het
Prima1 T A 12: 103,166,163 (GRCm39) I124F probably benign Het
Rbm34 T C 8: 127,676,169 (GRCm39) K382R probably benign Het
Rftn1 T G 17: 50,354,435 (GRCm39) N309T probably damaging Het
Septin1 C T 7: 126,814,598 (GRCm39) D260N probably damaging Het
Serpina3g T C 12: 104,207,299 (GRCm39) V154A probably damaging Het
Spef2 A T 15: 9,609,606 (GRCm39) N1306K probably damaging Het
Stk4 T C 2: 163,921,486 (GRCm39) F29S probably damaging Het
Stxbp5 A G 10: 9,645,490 (GRCm39) probably benign Het
Tbl3 T C 17: 24,919,733 (GRCm39) T774A probably benign Het
Tinag A G 9: 76,952,694 (GRCm39) Y97H probably damaging Het
Tpm1 T C 9: 66,956,317 (GRCm39) E33G probably damaging Het
Usp17lb T C 7: 104,489,847 (GRCm39) E359G probably benign Het
Vmn2r91 A G 17: 18,356,763 (GRCm39) E810G probably damaging Het
Vwce A T 19: 10,635,402 (GRCm39) T633S possibly damaging Het
Ylpm1 G A 12: 85,075,627 (GRCm39) R326H probably damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAAGGATTCACCCATCC -3'
(R):5'- AAAACCAGAGCTTTGCAGGACTG -3'

Sequencing Primer
(F):5'- CGCCGTGCCGTGAAAGATAC -3'
(R):5'- TGCCACACTGGTAGCACC -3'
Posted On 2016-10-26