Incidental Mutation 'R5606:Uox'
ID439285
Institutional Source Beutler Lab
Gene Symbol Uox
Ensembl Gene ENSMUSG00000028186
Gene Nameurate oxidase
Synonyms
MMRRC Submission 043157-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R5606 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location146570426-146632305 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 146610302 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 21 (Y21*)
Ref Sequence ENSEMBL: ENSMUSP00000029837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029837] [ENSMUST00000121133] [ENSMUST00000147409] [ENSMUST00000199489] [ENSMUST00000200633]
Predicted Effect probably null
Transcript: ENSMUST00000029837
AA Change: Y21*
SMART Domains Protein: ENSMUSP00000029837
Gene: ENSMUSG00000028186
AA Change: Y21*

DomainStartEndE-ValueType
Pfam:Uricase 19 144 8.7e-25 PFAM
Pfam:Uricase 153 292 5.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121133
SMART Domains Protein: ENSMUSP00000113649
Gene: ENSMUSG00000028186

DomainStartEndE-ValueType
Pfam:Uricase 2 72 1.2e-19 PFAM
Pfam:Uricase 79 181 8.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138921
Predicted Effect probably benign
Transcript: ENSMUST00000147409
SMART Domains Protein: ENSMUSP00000143299
Gene: ENSMUSG00000028186

DomainStartEndE-ValueType
Pfam:Uricase 1 73 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197320
Predicted Effect probably benign
Transcript: ENSMUST00000199489
SMART Domains Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186

DomainStartEndE-ValueType
Pfam:Uricase 1 121 8.3e-35 PFAM
Pfam:Uricase 128 228 1.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200633
SMART Domains Protein: ENSMUSP00000142872
Gene: ENSMUSG00000028185

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DNase_II 26 353 4.5e-117 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants exhibit marked hyperuricemia and urate nephropathy. Most mutants die prior to four weeks of age. Homozygotes for a large paracentric inversion disrupting this same gene exhibit a similar phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a7 A G 19: 20,722,367 S75P probably damaging Het
Ankib1 A T 5: 3,701,907 I711N probably damaging Het
Ankmy2 A G 12: 36,165,921 N40S probably benign Het
Armc8 T C 9: 99,536,262 K80E probably benign Het
BC005561 T C 5: 104,521,878 I1422T probably benign Het
Blm C A 7: 80,460,832 probably null Het
Cand1 C A 10: 119,211,454 Q710H possibly damaging Het
Ckap2l A T 2: 129,286,039 I73N probably damaging Het
Ddx27 T A 2: 167,019,966 D129E probably benign Het
Dnm3 T C 1: 162,286,018 E491G probably damaging Het
Fgd6 C A 10: 94,138,328 Y1310* probably null Het
Gm7534 A C 4: 134,200,212 V410G probably benign Het
Hnrnph3 C T 10: 63,019,443 R21H possibly damaging Het
Hs3st4 C A 7: 124,397,142 Q344K probably damaging Het
Hyal3 T C 9: 107,585,066 S100P probably benign Het
Map3k19 G A 1: 127,822,957 R886C probably benign Het
Mmrn2 G A 14: 34,397,624 D187N probably damaging Het
Myo5c G A 9: 75,275,508 A810T probably damaging Het
Noxa1 T A 2: 25,086,280 E332V possibly damaging Het
Olfr129 T C 17: 38,054,802 T264A probably damaging Het
Olfr1356 A G 10: 78,847,561 M118T probably benign Het
Olfr536 T A 7: 140,503,800 I220F probably damaging Het
Olfr550 T C 7: 102,579,274 S260P probably damaging Het
Parg T A 14: 32,262,736 V241E probably damaging Het
Pitrm1 T A 13: 6,560,065 V391D probably damaging Het
Plch1 A T 3: 63,740,687 V421E probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Spta1 A T 1: 174,219,902 H1704L probably damaging Het
Tbpl2 G A 2: 24,087,233 P258S possibly damaging Het
Tlr11 T C 14: 50,362,260 C568R probably benign Het
Tmem260 T A 14: 48,484,980 M324K probably damaging Het
Tmprss11g T A 5: 86,487,410 T402S probably damaging Het
Trim21 C G 7: 102,559,606 R302P probably damaging Het
Vmn1r74 A G 7: 11,846,895 M41V probably benign Het
Vmn2r59 A C 7: 42,045,894 S365A probably benign Het
Zfp345 A T 2: 150,474,868 Y6* probably null Het
Other mutations in Uox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Uox APN 3 146627810 missense probably benign 0.00
IGL00902:Uox APN 3 146610406 missense possibly damaging 0.95
IGL02409:Uox APN 3 146624626 missense probably benign 0.06
IGL02827:Uox APN 3 146597196 intron probably benign
IGL02979:Uox APN 3 146610491 splice site probably null
IGL03375:Uox APN 3 146625835 missense probably damaging 1.00
kamloops UTSW 3 146624577 nonsense probably null
R1350:Uox UTSW 3 146624575 missense probably damaging 1.00
R1634:Uox UTSW 3 146612383 nonsense probably null
R1900:Uox UTSW 3 146610379 missense probably damaging 1.00
R2000:Uox UTSW 3 146610399 missense possibly damaging 0.65
R2119:Uox UTSW 3 146612542 missense probably benign 0.01
R5329:Uox UTSW 3 146624545 missense probably damaging 1.00
R6281:Uox UTSW 3 146624577 nonsense probably null
R6327:Uox UTSW 3 146624577 nonsense probably null
R6337:Uox UTSW 3 146624577 nonsense probably null
R6364:Uox UTSW 3 146624577 nonsense probably null
R6365:Uox UTSW 3 146624577 nonsense probably null
R6369:Uox UTSW 3 146624577 nonsense probably null
R6483:Uox UTSW 3 146624577 nonsense probably null
R6492:Uox UTSW 3 146624577 nonsense probably null
R6494:Uox UTSW 3 146624577 nonsense probably null
R6556:Uox UTSW 3 146624648 critical splice donor site probably null
R6803:Uox UTSW 3 146612509 missense possibly damaging 0.91
R7809:Uox UTSW 3 146627858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTCAGGCGTGATACTGC -3'
(R):5'- TTTGCATCAGGAAGTAGCAAGC -3'

Sequencing Primer
(F):5'- CAGGCGTGATACTGCTTTCCTAAG -3'
(R):5'- AGAGTGATTATACCCCTCTGAGC -3'
Posted On2016-10-26