Mutagenetix > Incidental Mutation

Incidental Mutation 'R5606:Blm'

439292

Institutional Source

Beutler Lab

Gene Symbol

Blm

Ensembl Gene

ENSMUSG00000030528

Gene Name

Bloom syndrome, RecQ like helicase

Synonyms

MMRRC Submission

043157-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5606 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80454733-80535119 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to A at 80460832 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]

AlphaFold

O88700

Predicted Effect

probably null
Transcript: ENSMUST00000081314
AA Change: E1263*

SMART Domains

Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: E1263*

Domain	Start	End	E-Value	Type
low complexity region	46	54	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	219	231	N/A	INTRINSIC
low complexity region	318	335	N/A	INTRINSIC
Pfam:BDHCT	376	416	5.5e-27	PFAM
low complexity region	557	574	N/A	INTRINSIC
DEXDc	672	873	1.59e-29	SMART
HELICc	910	992	1.29e-24	SMART
RQC	1084	1198	1.43e-15	SMART
HRDC	1217	1297	9.4e-20	SMART
low complexity region	1357	1371	N/A	INTRINSIC
low complexity region	1378	1392	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000170315
AA Change: E1266*

SMART Domains

Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: E1266*

Domain	Start	End	E-Value	Type
Pfam:BLM_N	4	375	1.1e-161	PFAM
Pfam:BDHCT	380	419	6.4e-25	PFAM
Pfam:BDHCT_assoc	433	658	8.8e-108	PFAM
DEXDc	675	876	1.59e-29	SMART
HELICc	913	995	1.29e-24	SMART
Pfam:RecQ_Zn_bind	1006	1078	1.5e-19	PFAM
RQC	1087	1201	1.43e-15	SMART
HRDC	1220	1300	9.4e-20	SMART
low complexity region	1360	1374	N/A	INTRINSIC
low complexity region	1381	1395	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205730

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206518

Predicted Effect

probably null
Transcript: ENSMUST00000206901

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206948

Predicted Effect

probably benign
Transcript: ENSMUST00000206989

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1a7	A	G	19: 20,722,367	S75P	probably damaging	Het
Ankib1	A	T	5: 3,701,907	I711N	probably damaging	Het
Ankmy2	A	G	12: 36,165,921	N40S	probably benign	Het
Armc8	T	C	9: 99,536,262	K80E	probably benign	Het
BC005561	T	C	5: 104,521,878	I1422T	probably benign	Het
Cand1	C	A	10: 119,211,454	Q710H	possibly damaging	Het
Ckap2l	A	T	2: 129,286,039	I73N	probably damaging	Het
Ddx27	T	A	2: 167,019,966	D129E	probably benign	Het
Dnm3	T	C	1: 162,286,018	E491G	probably damaging	Het
Fgd6	C	A	10: 94,138,328	Y1310*	probably null	Het
Gm7534	A	C	4: 134,200,212	V410G	probably benign	Het
Hnrnph3	C	T	10: 63,019,443	R21H	possibly damaging	Het
Hs3st4	C	A	7: 124,397,142	Q344K	probably damaging	Het
Hyal3	T	C	9: 107,585,066	S100P	probably benign	Het
Map3k19	G	A	1: 127,822,957	R886C	probably benign	Het
Mmrn2	G	A	14: 34,397,624	D187N	probably damaging	Het
Myo5c	G	A	9: 75,275,508	A810T	probably damaging	Het
Noxa1	T	A	2: 25,086,280	E332V	possibly damaging	Het
Olfr129	T	C	17: 38,054,802	T264A	probably damaging	Het
Olfr1356	A	G	10: 78,847,561	M118T	probably benign	Het
Olfr536	T	A	7: 140,503,800	I220F	probably damaging	Het
Olfr550	T	C	7: 102,579,274	S260P	probably damaging	Het
Parg	T	A	14: 32,262,736	V241E	probably damaging	Het
Pitrm1	T	A	13: 6,560,065	V391D	probably damaging	Het
Plch1	A	T	3: 63,740,687	V421E	probably benign	Het
Slc27a2	C	T	2: 126,564,690	A98V	probably damaging	Het
Spta1	A	T	1: 174,219,902	H1704L	probably damaging	Het
Tbpl2	G	A	2: 24,087,233	P258S	possibly damaging	Het
Tlr11	T	C	14: 50,362,260	C568R	probably benign	Het
Tmem260	T	A	14: 48,484,980	M324K	probably damaging	Het
Tmprss11g	T	A	5: 86,487,410	T402S	probably damaging	Het
Trim21	C	G	7: 102,559,606	R302P	probably damaging	Het
Uox	T	A	3: 146,610,302	Y21*	probably null	Het
Vmn1r74	A	G	7: 11,846,895	M41V	probably benign	Het
Vmn2r59	A	C	7: 42,045,894	S365A	probably benign	Het
Zfp345	A	T	2: 150,474,868	Y6*	probably null	Het

Other mutations in Blm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01531:Blm	APN	7	80474071	missense	probably damaging	1.00
IGL01658:Blm	APN	7	80463941	missense	probably damaging	0.98
IGL02048:Blm	APN	7	80502961	splice site	probably benign
IGL02060:Blm	APN	7	80514580	splice site	probably benign
IGL02063:Blm	APN	7	80509419	nonsense	probably null
IGL02102:Blm	APN	7	80469756	missense	probably damaging	1.00
IGL02420:Blm	APN	7	80496006	missense	probably damaging	1.00
IGL02452:Blm	APN	7	80503377	splice site	probably null
IGL02566:Blm	APN	7	80474196	missense	probably damaging	1.00
IGL03387:Blm	APN	7	80494147	missense	probably damaging	1.00
FR4304:Blm	UTSW	7	80463773	frame shift	probably null
FR4304:Blm	UTSW	7	80512919	small insertion	probably benign
FR4340:Blm	UTSW	7	80463767	unclassified	probably benign
FR4340:Blm	UTSW	7	80512907	small insertion	probably benign
FR4340:Blm	UTSW	7	80512910	small insertion	probably benign
FR4449:Blm	UTSW	7	80512908	small insertion	probably benign
FR4548:Blm	UTSW	7	80463769	frame shift	probably null
FR4589:Blm	UTSW	7	80463770	frame shift	probably null
FR4737:Blm	UTSW	7	80463771	frame shift	probably null
FR4737:Blm	UTSW	7	80463774	frame shift	probably null
FR4976:Blm	UTSW	7	80463767	unclassified	probably benign
FR4976:Blm	UTSW	7	80512907	small insertion	probably benign
R0133:Blm	UTSW	7	80502367	missense	possibly damaging	0.93
R0194:Blm	UTSW	7	80464946	unclassified	probably benign
R0526:Blm	UTSW	7	80505893	nonsense	probably null
R0673:Blm	UTSW	7	80499751	critical splice donor site	probably null
R0972:Blm	UTSW	7	80513370	missense	probably benign
R0980:Blm	UTSW	7	80499958	splice site	probably null
R1120:Blm	UTSW	7	80481466	missense	probably damaging	1.00
R1301:Blm	UTSW	7	80455417	nonsense	probably null
R1769:Blm	UTSW	7	80513370	missense	probably benign
R1866:Blm	UTSW	7	80494114	missense	probably benign	0.08
R1874:Blm	UTSW	7	80497418	missense	probably damaging	1.00
R1966:Blm	UTSW	7	80513186	missense	possibly damaging	0.86
R1991:Blm	UTSW	7	80505949	splice site	probably null
R2013:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2014:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2015:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2016:Blm	UTSW	7	80505926	missense	probably benign	0.26
R2103:Blm	UTSW	7	80505949	splice site	probably null
R2161:Blm	UTSW	7	80481370	splice site	probably null
R2215:Blm	UTSW	7	80499847	missense	possibly damaging	0.69
R3689:Blm	UTSW	7	80513079	missense	possibly damaging	0.56
R4049:Blm	UTSW	7	80502862	missense	probably benign	0.04
R4155:Blm	UTSW	7	80512904	small deletion	probably benign
R4695:Blm	UTSW	7	80494228	missense	probably damaging	1.00
R4774:Blm	UTSW	7	80463848	missense	probably damaging	1.00
R4833:Blm	UTSW	7	80466826	missense	probably benign
R4835:Blm	UTSW	7	80509546	missense	probably benign	0.41
R4994:Blm	UTSW	7	80458825	missense	probably benign	0.00
R5039:Blm	UTSW	7	80505873	missense	possibly damaging	0.50
R5330:Blm	UTSW	7	80458936	missense	possibly damaging	0.73
R5375:Blm	UTSW	7	80513229	missense	probably benign	0.00
R5408:Blm	UTSW	7	80502622	missense	probably benign	0.01
R5574:Blm	UTSW	7	80499773	missense	probably damaging	1.00
R5702:Blm	UTSW	7	80458927	missense	probably benign	0.13
R5809:Blm	UTSW	7	80464844	missense	probably damaging	1.00
R6114:Blm	UTSW	7	80513487	missense	probably damaging	1.00
R6157:Blm	UTSW	7	80512985	missense	probably benign	0.18
R6163:Blm	UTSW	7	80512904	small deletion	probably benign
R6254:Blm	UTSW	7	80480342	missense	probably benign	0.04
R6266:Blm	UTSW	7	80499940	missense	probably benign	0.03
R6364:Blm	UTSW	7	80494526	nonsense	probably null
R6446:Blm	UTSW	7	80512904	small deletion	probably benign
R6502:Blm	UTSW	7	80481475	missense	probably damaging	0.98
R6700:Blm	UTSW	7	80463850	missense	possibly damaging	0.91
R7002:Blm	UTSW	7	80469753	missense	probably benign	0.00
R7105:Blm	UTSW	7	80499768	missense	probably benign	0.44
R7320:Blm	UTSW	7	80455354	nonsense	probably null
R7465:Blm	UTSW	7	80513115	missense	probably benign	0.02
R7561:Blm	UTSW	7	80502528	missense	probably damaging	0.99
R8500:Blm	UTSW	7	80455284	missense	probably damaging	1.00
R8543:Blm	UTSW	7	80494216	missense	probably damaging	0.98
R8774-TAIL:Blm	UTSW	7	80512907	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512918	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512919	small insertion	probably benign
R8775-TAIL:Blm	UTSW	7	80512931	small insertion	probably benign
R8860:Blm	UTSW	7	80494528	missense	probably benign	0.30
R8928:Blm	UTSW	7	80512904	small deletion	probably benign
R9089:Blm	UTSW	7	80513119	missense	probably damaging	1.00
R9363:Blm	UTSW	7	80458915	missense	probably damaging	1.00
RF001:Blm	UTSW	7	80512903	small insertion	probably benign
RF001:Blm	UTSW	7	80512906	small insertion	probably benign
RF001:Blm	UTSW	7	80512927	small insertion	probably benign
RF002:Blm	UTSW	7	80512905	small insertion	probably benign
RF002:Blm	UTSW	7	80512927	small insertion	probably benign
RF007:Blm	UTSW	7	80512933	nonsense	probably null
RF016:Blm	UTSW	7	80512926	nonsense	probably null
RF018:Blm	UTSW	7	80512926	nonsense	probably null
RF027:Blm	UTSW	7	80512914	frame shift	probably null
RF028:Blm	UTSW	7	80512905	nonsense	probably null
RF031:Blm	UTSW	7	80512906	small insertion	probably benign
RF031:Blm	UTSW	7	80512923	small insertion	probably benign
RF032:Blm	UTSW	7	80512930	small insertion	probably benign
RF036:Blm	UTSW	7	80512914	nonsense	probably null
RF044:Blm	UTSW	7	80512930	small insertion	probably benign
RF053:Blm	UTSW	7	80512921	small insertion	probably benign
RF064:Blm	UTSW	7	80512923	nonsense	probably null
X0061:Blm	UTSW	7	80458850	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TGTAGGATGCATTAACTACCTGG -3'
(R):5'- CCTGTGTGCTGCATTTCCAG -3'

Sequencing Primer
(F):5'- GATGCATTAACTACCTGGTGCCAG -3'
(R):5'- GTGTGCTGCATTTCCAGTCTAAC -3'

Posted On

2016-10-26