Incidental Mutation 'R5606:Trim21'
ID439293
Institutional Source Beutler Lab
Gene Symbol Trim21
Ensembl Gene ENSMUSG00000030966
Gene Nametripartite motif-containing 21
SynonymsSsa1, Ro52
MMRRC Submission 043157-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5606 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102557921-102565486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 102559606 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 302 (R302P)
Ref Sequence ENSEMBL: ENSMUSP00000102526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033264] [ENSMUST00000098227] [ENSMUST00000106913] [ENSMUST00000217478]
Predicted Effect probably damaging
Transcript: ENSMUST00000033264
AA Change: R302P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033264
Gene: ENSMUSG00000030966
AA Change: R302P

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098227
SMART Domains Protein: ENSMUSP00000095829
Gene: ENSMUSG00000073977

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.7e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 225 1.2e-11 PFAM
Pfam:7tm_1 43 294 1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106913
AA Change: R302P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102526
Gene: ENSMUSG00000030966
AA Change: R302P

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209907
Predicted Effect probably benign
Transcript: ENSMUST00000217478
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The encoded protein is part of the RoSSA ribonucleoprotein, which includes a single polypeptide and one of four small RNA molecules. The RoSSA particle localizes to both the cytoplasm and the nucleus. RoSSA interacts with autoantigens in patients with Sjogren syndrome and systemic lupus erythematosus. Alternatively spliced transcript variants for this gene have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Unmanipulated homozygous mice are normal, but leads to tissue inflammation and systemic autoimmunity in vivo and reduced number of CD11c+ dendritic cells from mutant bone marrow in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a7 A G 19: 20,722,367 S75P probably damaging Het
Ankib1 A T 5: 3,701,907 I711N probably damaging Het
Ankmy2 A G 12: 36,165,921 N40S probably benign Het
Armc8 T C 9: 99,536,262 K80E probably benign Het
BC005561 T C 5: 104,521,878 I1422T probably benign Het
Blm C A 7: 80,460,832 probably null Het
Cand1 C A 10: 119,211,454 Q710H possibly damaging Het
Ckap2l A T 2: 129,286,039 I73N probably damaging Het
Ddx27 T A 2: 167,019,966 D129E probably benign Het
Dnm3 T C 1: 162,286,018 E491G probably damaging Het
Fgd6 C A 10: 94,138,328 Y1310* probably null Het
Gm7534 A C 4: 134,200,212 V410G probably benign Het
Hnrnph3 C T 10: 63,019,443 R21H possibly damaging Het
Hs3st4 C A 7: 124,397,142 Q344K probably damaging Het
Hyal3 T C 9: 107,585,066 S100P probably benign Het
Map3k19 G A 1: 127,822,957 R886C probably benign Het
Mmrn2 G A 14: 34,397,624 D187N probably damaging Het
Myo5c G A 9: 75,275,508 A810T probably damaging Het
Noxa1 T A 2: 25,086,280 E332V possibly damaging Het
Olfr129 T C 17: 38,054,802 T264A probably damaging Het
Olfr1356 A G 10: 78,847,561 M118T probably benign Het
Olfr536 T A 7: 140,503,800 I220F probably damaging Het
Olfr550 T C 7: 102,579,274 S260P probably damaging Het
Parg T A 14: 32,262,736 V241E probably damaging Het
Pitrm1 T A 13: 6,560,065 V391D probably damaging Het
Plch1 A T 3: 63,740,687 V421E probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Spta1 A T 1: 174,219,902 H1704L probably damaging Het
Tbpl2 G A 2: 24,087,233 P258S possibly damaging Het
Tlr11 T C 14: 50,362,260 C568R probably benign Het
Tmem260 T A 14: 48,484,980 M324K probably damaging Het
Tmprss11g T A 5: 86,487,410 T402S probably damaging Het
Uox T A 3: 146,610,302 Y21* probably null Het
Vmn1r74 A G 7: 11,846,895 M41V probably benign Het
Vmn2r59 A C 7: 42,045,894 S365A probably benign Het
Zfp345 A T 2: 150,474,868 Y6* probably null Het
Other mutations in Trim21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Trim21 APN 7 102559598 missense probably damaging 1.00
IGL01729:Trim21 APN 7 102563893 missense probably damaging 0.97
IGL02680:Trim21 APN 7 102559663 missense probably benign 0.44
IGL03349:Trim21 APN 7 102563277 missense probably benign 0.00
R1508:Trim21 UTSW 7 102559576 missense possibly damaging 0.52
R1662:Trim21 UTSW 7 102561898 nonsense probably null
R2904:Trim21 UTSW 7 102559971 missense probably benign 0.00
R4482:Trim21 UTSW 7 102563933 nonsense probably null
R5480:Trim21 UTSW 7 102559256 missense probably benign 0.05
R6130:Trim21 UTSW 7 102563291 missense possibly damaging 0.95
R6214:Trim21 UTSW 7 102559439 missense probably damaging 0.96
R6215:Trim21 UTSW 7 102559439 missense probably damaging 0.96
R6291:Trim21 UTSW 7 102564082 missense probably damaging 1.00
R6731:Trim21 UTSW 7 102559212 missense probably damaging 1.00
R7612:Trim21 UTSW 7 102559535 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGGACTGAGTGAAAACTGC -3'
(R):5'- AGAGTAACTGTGGGTCATTTCC -3'

Sequencing Primer
(F):5'- GGACTGAGTGAAAACTGCCCTTTC -3'
(R):5'- GTAACTGTGGGTCATTTCCTCACATG -3'
Posted On2016-10-26