Incidental Mutation 'R5606:Hs3st4'
ID439295
Institutional Source Beutler Lab
Gene Symbol Hs3st4
Ensembl Gene ENSMUSG00000078591
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 4
SynonymsGm6915
MMRRC Submission 043157-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5606 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location123982869-124398989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 124397142 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 344 (Q344K)
Ref Sequence ENSEMBL: ENSMUSP00000102045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106437]
Predicted Effect probably damaging
Transcript: ENSMUST00000106437
AA Change: Q344K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102045
Gene: ENSMUSG00000078591
AA Change: Q344K

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 52 60 N/A INTRINSIC
low complexity region 68 94 N/A INTRINSIC
low complexity region 106 112 N/A INTRINSIC
low complexity region 158 171 N/A INTRINSIC
Pfam:Sulfotransfer_1 190 439 6.4e-46 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme heparan sulfate D-glucosaminyl 3-O-sulfotransferase 4. This enzyme generates 3-O-sulfated glucosaminyl residues in heparan sulfate. Cell surface heparan sulfate is used as a receptor by herpes simplex virus type 1 (HSV-1), and expression of this gene is thought to play a role in HSV-1 pathogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a7 A G 19: 20,722,367 S75P probably damaging Het
Ankib1 A T 5: 3,701,907 I711N probably damaging Het
Ankmy2 A G 12: 36,165,921 N40S probably benign Het
Armc8 T C 9: 99,536,262 K80E probably benign Het
BC005561 T C 5: 104,521,878 I1422T probably benign Het
Blm C A 7: 80,460,832 probably null Het
Cand1 C A 10: 119,211,454 Q710H possibly damaging Het
Ckap2l A T 2: 129,286,039 I73N probably damaging Het
Ddx27 T A 2: 167,019,966 D129E probably benign Het
Dnm3 T C 1: 162,286,018 E491G probably damaging Het
Fgd6 C A 10: 94,138,328 Y1310* probably null Het
Gm7534 A C 4: 134,200,212 V410G probably benign Het
Hnrnph3 C T 10: 63,019,443 R21H possibly damaging Het
Hyal3 T C 9: 107,585,066 S100P probably benign Het
Map3k19 G A 1: 127,822,957 R886C probably benign Het
Mmrn2 G A 14: 34,397,624 D187N probably damaging Het
Myo5c G A 9: 75,275,508 A810T probably damaging Het
Noxa1 T A 2: 25,086,280 E332V possibly damaging Het
Olfr129 T C 17: 38,054,802 T264A probably damaging Het
Olfr1356 A G 10: 78,847,561 M118T probably benign Het
Olfr536 T A 7: 140,503,800 I220F probably damaging Het
Olfr550 T C 7: 102,579,274 S260P probably damaging Het
Parg T A 14: 32,262,736 V241E probably damaging Het
Pitrm1 T A 13: 6,560,065 V391D probably damaging Het
Plch1 A T 3: 63,740,687 V421E probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Spta1 A T 1: 174,219,902 H1704L probably damaging Het
Tbpl2 G A 2: 24,087,233 P258S possibly damaging Het
Tlr11 T C 14: 50,362,260 C568R probably benign Het
Tmem260 T A 14: 48,484,980 M324K probably damaging Het
Tmprss11g T A 5: 86,487,410 T402S probably damaging Het
Trim21 C G 7: 102,559,606 R302P probably damaging Het
Uox T A 3: 146,610,302 Y21* probably null Het
Vmn1r74 A G 7: 11,846,895 M41V probably benign Het
Vmn2r59 A C 7: 42,045,894 S365A probably benign Het
Zfp345 A T 2: 150,474,868 Y6* probably null Het
Other mutations in Hs3st4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Hs3st4 APN 7 124397313 missense probably damaging 1.00
IGL03078:Hs3st4 APN 7 124397446 missense probably damaging 1.00
R0138:Hs3st4 UTSW 7 124397193 missense probably benign 0.01
R1697:Hs3st4 UTSW 7 124396857 missense probably benign
R2063:Hs3st4 UTSW 7 124397013 missense probably benign 0.42
R4891:Hs3st4 UTSW 7 124396829 missense possibly damaging 0.57
R4922:Hs3st4 UTSW 7 124397187 missense probably damaging 1.00
R5084:Hs3st4 UTSW 7 124397295 missense probably damaging 1.00
R5736:Hs3st4 UTSW 7 124397439 missense probably damaging 0.99
R5859:Hs3st4 UTSW 7 123983608 missense probably benign 0.12
R6861:Hs3st4 UTSW 7 124396829 missense possibly damaging 0.57
R7429:Hs3st4 UTSW 7 124397382 missense probably damaging 1.00
R7431:Hs3st4 UTSW 7 123983290 missense probably damaging 0.99
R7472:Hs3st4 UTSW 7 124397026 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTACGAAACCCAGTGACCAG -3'
(R):5'- GTCAATTCGGGGATGAGTCC -3'

Sequencing Primer
(F):5'- GACCAGGGCCATTTCTGACTATAC -3'
(R):5'- GGATGAGTCCGACCTTTGCTC -3'
Posted On2016-10-26