Incidental Mutation 'R5606:Olfr536'
ID439296
Institutional Source Beutler Lab
Gene Symbol Olfr536
Ensembl Gene ENSMUSG00000052508
Gene Nameolfactory receptor 536
SynonymsGA_x6K02T2PBJ9-42653501-42652578, MOR252-1, MOR252-4
MMRRC Submission 043157-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5606 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140500849-140507396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140503800 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 220 (I220F)
Ref Sequence ENSEMBL: ENSMUSP00000149758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064392] [ENSMUST00000209873] [ENSMUST00000215340] [ENSMUST00000215768]
Predicted Effect probably damaging
Transcript: ENSMUST00000064392
AA Change: I220F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067699
Gene: ENSMUSG00000052508
AA Change: I220F

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 8.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 304 5.4e-6 PFAM
Pfam:7tm_1 41 289 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211326
Predicted Effect probably damaging
Transcript: ENSMUST00000215340
AA Change: I220F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215768
AA Change: I220F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a7 A G 19: 20,722,367 S75P probably damaging Het
Ankib1 A T 5: 3,701,907 I711N probably damaging Het
Ankmy2 A G 12: 36,165,921 N40S probably benign Het
Armc8 T C 9: 99,536,262 K80E probably benign Het
BC005561 T C 5: 104,521,878 I1422T probably benign Het
Blm C A 7: 80,460,832 probably null Het
Cand1 C A 10: 119,211,454 Q710H possibly damaging Het
Ckap2l A T 2: 129,286,039 I73N probably damaging Het
Ddx27 T A 2: 167,019,966 D129E probably benign Het
Dnm3 T C 1: 162,286,018 E491G probably damaging Het
Fgd6 C A 10: 94,138,328 Y1310* probably null Het
Gm7534 A C 4: 134,200,212 V410G probably benign Het
Hnrnph3 C T 10: 63,019,443 R21H possibly damaging Het
Hs3st4 C A 7: 124,397,142 Q344K probably damaging Het
Hyal3 T C 9: 107,585,066 S100P probably benign Het
Map3k19 G A 1: 127,822,957 R886C probably benign Het
Mmrn2 G A 14: 34,397,624 D187N probably damaging Het
Myo5c G A 9: 75,275,508 A810T probably damaging Het
Noxa1 T A 2: 25,086,280 E332V possibly damaging Het
Olfr129 T C 17: 38,054,802 T264A probably damaging Het
Olfr1356 A G 10: 78,847,561 M118T probably benign Het
Olfr550 T C 7: 102,579,274 S260P probably damaging Het
Parg T A 14: 32,262,736 V241E probably damaging Het
Pitrm1 T A 13: 6,560,065 V391D probably damaging Het
Plch1 A T 3: 63,740,687 V421E probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Spta1 A T 1: 174,219,902 H1704L probably damaging Het
Tbpl2 G A 2: 24,087,233 P258S possibly damaging Het
Tlr11 T C 14: 50,362,260 C568R probably benign Het
Tmem260 T A 14: 48,484,980 M324K probably damaging Het
Tmprss11g T A 5: 86,487,410 T402S probably damaging Het
Trim21 C G 7: 102,559,606 R302P probably damaging Het
Uox T A 3: 146,610,302 Y21* probably null Het
Vmn1r74 A G 7: 11,846,895 M41V probably benign Het
Vmn2r59 A C 7: 42,045,894 S365A probably benign Het
Zfp345 A T 2: 150,474,868 Y6* probably null Het
Other mutations in Olfr536
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr536 APN 7 140504184 missense probably damaging 1.00
IGL02065:Olfr536 APN 7 140504164 missense probably benign 0.02
IGL02812:Olfr536 APN 7 140503620 missense probably damaging 0.99
IGL02896:Olfr536 APN 7 140504055 splice site probably null
IGL03281:Olfr536 APN 7 140503800 missense probably damaging 1.00
R2440:Olfr536 UTSW 7 140503552 missense probably benign 0.25
R3110:Olfr536 UTSW 7 140503919 missense probably damaging 0.99
R3112:Olfr536 UTSW 7 140503919 missense probably damaging 0.99
R4349:Olfr536 UTSW 7 140504357 nonsense probably null
R4660:Olfr536 UTSW 7 140504020 missense probably benign 0.03
R4827:Olfr536 UTSW 7 140503670 missense probably damaging 0.96
R5607:Olfr536 UTSW 7 140504405 missense probably benign 0.10
R7102:Olfr536 UTSW 7 140504316 missense probably benign 0.05
R7354:Olfr536 UTSW 7 140504186 missense probably damaging 1.00
R8081:Olfr536 UTSW 7 140504456 start codon destroyed probably null 1.00
R8095:Olfr536 UTSW 7 140504279 missense probably damaging 1.00
R8520:Olfr536 UTSW 7 140504402 missense probably benign 0.14
Z1088:Olfr536 UTSW 7 140503805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAGATGGGGTCACAGTTGTG -3'
(R):5'- AGCTCTCAATTCCTTGGTGC -3'

Sequencing Primer
(F):5'- GTACGGAATAGCAATGACCTTGTCC -3'
(R):5'- ACTTGTCTGGTGTTGCCAC -3'
Posted On2016-10-26