Incidental Mutation 'R5606:Ankmy2'
ID439304
Institutional Source Beutler Lab
Gene Symbol Ankmy2
Ensembl Gene ENSMUSG00000036188
Gene Nameankyrin repeat and MYND domain containing 2
Synonyms
MMRRC Submission 043157-MU
Accession Numbers

Genbank: NM_146033; MGI: 2144755

Is this an essential gene? Possibly essential (E-score: 0.665) question?
Stock #R5606 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location36157114-36197291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36165921 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 40 (N40S)
Ref Sequence ENSEMBL: ENSMUSP00000039484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041640]
Predicted Effect probably benign
Transcript: ENSMUST00000041640
AA Change: N40S

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000039484
Gene: ENSMUSG00000036188
AA Change: N40S

DomainStartEndE-ValueType
ANK 45 74 1.1e-6 SMART
ANK 79 108 7.83e-3 SMART
ANK 112 143 9.33e2 SMART
Pfam:zf-MYND 320 357 6.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220788
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a7 A G 19: 20,722,367 S75P probably damaging Het
Ankib1 A T 5: 3,701,907 I711N probably damaging Het
Armc8 T C 9: 99,536,262 K80E probably benign Het
BC005561 T C 5: 104,521,878 I1422T probably benign Het
Blm C A 7: 80,460,832 probably null Het
Cand1 C A 10: 119,211,454 Q710H possibly damaging Het
Ckap2l A T 2: 129,286,039 I73N probably damaging Het
Ddx27 T A 2: 167,019,966 D129E probably benign Het
Dnm3 T C 1: 162,286,018 E491G probably damaging Het
Fgd6 C A 10: 94,138,328 Y1310* probably null Het
Gm7534 A C 4: 134,200,212 V410G probably benign Het
Hnrnph3 C T 10: 63,019,443 R21H possibly damaging Het
Hs3st4 C A 7: 124,397,142 Q344K probably damaging Het
Hyal3 T C 9: 107,585,066 S100P probably benign Het
Map3k19 G A 1: 127,822,957 R886C probably benign Het
Mmrn2 G A 14: 34,397,624 D187N probably damaging Het
Myo5c G A 9: 75,275,508 A810T probably damaging Het
Noxa1 T A 2: 25,086,280 E332V possibly damaging Het
Olfr129 T C 17: 38,054,802 T264A probably damaging Het
Olfr1356 A G 10: 78,847,561 M118T probably benign Het
Olfr536 T A 7: 140,503,800 I220F probably damaging Het
Olfr550 T C 7: 102,579,274 S260P probably damaging Het
Parg T A 14: 32,262,736 V241E probably damaging Het
Pitrm1 T A 13: 6,560,065 V391D probably damaging Het
Plch1 A T 3: 63,740,687 V421E probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Spta1 A T 1: 174,219,902 H1704L probably damaging Het
Tbpl2 G A 2: 24,087,233 P258S possibly damaging Het
Tlr11 T C 14: 50,362,260 C568R probably benign Het
Tmem260 T A 14: 48,484,980 M324K probably damaging Het
Tmprss11g T A 5: 86,487,410 T402S probably damaging Het
Trim21 C G 7: 102,559,606 R302P probably damaging Het
Uox T A 3: 146,610,302 Y21* probably null Het
Vmn1r74 A G 7: 11,846,895 M41V probably benign Het
Vmn2r59 A C 7: 42,045,894 S365A probably benign Het
Zfp345 A T 2: 150,474,868 Y6* probably null Het
Other mutations in Ankmy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01971:Ankmy2 APN 12 36193793 nonsense probably null
IGL02588:Ankmy2 APN 12 36176686 splice site probably benign
IGL02975:Ankmy2 APN 12 36193774 missense possibly damaging 0.50
IGL03076:Ankmy2 APN 12 36165918 missense probably damaging 0.98
7510:Ankmy2 UTSW 12 36157412 missense probably benign 0.06
PIT4520001:Ankmy2 UTSW 12 36157391 missense probably benign 0.41
R0135:Ankmy2 UTSW 12 36170435 splice site probably benign
R0319:Ankmy2 UTSW 12 36165899 missense possibly damaging 0.76
R0347:Ankmy2 UTSW 12 36193754 missense probably damaging 1.00
R0485:Ankmy2 UTSW 12 36182390 missense possibly damaging 0.94
R0557:Ankmy2 UTSW 12 36187766 missense probably benign 0.38
R1304:Ankmy2 UTSW 12 36186805 missense probably damaging 0.99
R1397:Ankmy2 UTSW 12 36170441 splice site probably benign
R1572:Ankmy2 UTSW 12 36186942 critical splice donor site probably null
R1674:Ankmy2 UTSW 12 36187669 missense probably benign
R1874:Ankmy2 UTSW 12 36165931 missense possibly damaging 0.77
R1887:Ankmy2 UTSW 12 36170468 missense possibly damaging 0.71
R1985:Ankmy2 UTSW 12 36157364 missense possibly damaging 0.86
R1996:Ankmy2 UTSW 12 36193797 missense probably benign 0.00
R4964:Ankmy2 UTSW 12 36186918 missense possibly damaging 0.69
R5534:Ankmy2 UTSW 12 36182492 missense probably damaging 0.96
R5614:Ankmy2 UTSW 12 36193784 missense probably damaging 1.00
R5906:Ankmy2 UTSW 12 36176633 missense probably damaging 1.00
R6427:Ankmy2 UTSW 12 36187711 missense possibly damaging 0.49
R7065:Ankmy2 UTSW 12 36187708 missense probably damaging 0.96
R7135:Ankmy2 UTSW 12 36196312 missense probably benign
R7705:Ankmy2 UTSW 12 36195108 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ACCAATCAAAGCCAGCTGGG -3'
(R):5'- CATGCTCGTATGTGCACATATG -3'

Sequencing Primer
(F):5'- GGGCAGGGACCCTCAGG -3'
(R):5'- CAGAGTTCACTATCTGGGCTAGAC -3'
Posted On2016-10-26