Incidental Mutation 'R5606:Mmrn2'
ID439308
Institutional Source Beutler Lab
Gene Symbol Mmrn2
Ensembl Gene ENSMUSG00000041445
Gene Namemultimerin 2
SynonymsEmilin3, EndoGlyx-1, ENDOGLYX1
MMRRC Submission 043157-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5606 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34375465-34404287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34397624 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 187 (D187N)
Ref Sequence ENSEMBL: ENSMUSP00000107539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111908]
Predicted Effect probably damaging
Transcript: ENSMUST00000111908
AA Change: D187N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107539
Gene: ENSMUSG00000041445
AA Change: D187N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 55 127 1.1e-15 PFAM
low complexity region 174 186 N/A INTRINSIC
low complexity region 356 362 N/A INTRINSIC
coiled coil region 387 480 N/A INTRINSIC
coiled coil region 533 583 N/A INTRINSIC
coiled coil region 688 715 N/A INTRINSIC
Pfam:C1q 821 940 1.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227130
AA Change: D108N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transforming growth factor beta antagonist and can interfere with the VEGF-A/VEGFR2 pathway. A related pseudogene has been identified on chromosome 6. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a7 A G 19: 20,722,367 S75P probably damaging Het
Ankib1 A T 5: 3,701,907 I711N probably damaging Het
Ankmy2 A G 12: 36,165,921 N40S probably benign Het
Armc8 T C 9: 99,536,262 K80E probably benign Het
BC005561 T C 5: 104,521,878 I1422T probably benign Het
Blm C A 7: 80,460,832 probably null Het
Cand1 C A 10: 119,211,454 Q710H possibly damaging Het
Ckap2l A T 2: 129,286,039 I73N probably damaging Het
Ddx27 T A 2: 167,019,966 D129E probably benign Het
Dnm3 T C 1: 162,286,018 E491G probably damaging Het
Fgd6 C A 10: 94,138,328 Y1310* probably null Het
Gm7534 A C 4: 134,200,212 V410G probably benign Het
Hnrnph3 C T 10: 63,019,443 R21H possibly damaging Het
Hs3st4 C A 7: 124,397,142 Q344K probably damaging Het
Hyal3 T C 9: 107,585,066 S100P probably benign Het
Map3k19 G A 1: 127,822,957 R886C probably benign Het
Myo5c G A 9: 75,275,508 A810T probably damaging Het
Noxa1 T A 2: 25,086,280 E332V possibly damaging Het
Olfr129 T C 17: 38,054,802 T264A probably damaging Het
Olfr1356 A G 10: 78,847,561 M118T probably benign Het
Olfr536 T A 7: 140,503,800 I220F probably damaging Het
Olfr550 T C 7: 102,579,274 S260P probably damaging Het
Parg T A 14: 32,262,736 V241E probably damaging Het
Pitrm1 T A 13: 6,560,065 V391D probably damaging Het
Plch1 A T 3: 63,740,687 V421E probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Spta1 A T 1: 174,219,902 H1704L probably damaging Het
Tbpl2 G A 2: 24,087,233 P258S possibly damaging Het
Tlr11 T C 14: 50,362,260 C568R probably benign Het
Tmem260 T A 14: 48,484,980 M324K probably damaging Het
Tmprss11g T A 5: 86,487,410 T402S probably damaging Het
Trim21 C G 7: 102,559,606 R302P probably damaging Het
Uox T A 3: 146,610,302 Y21* probably null Het
Vmn1r74 A G 7: 11,846,895 M41V probably benign Het
Vmn2r59 A C 7: 42,045,894 S365A probably benign Het
Zfp345 A T 2: 150,474,868 Y6* probably null Het
Other mutations in Mmrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Mmrn2 APN 14 34403217 missense probably damaging 1.00
IGL02529:Mmrn2 APN 14 34398613 missense possibly damaging 0.74
IGL02590:Mmrn2 APN 14 34399267 nonsense probably null
P0037:Mmrn2 UTSW 14 34403065 missense probably damaging 1.00
R0323:Mmrn2 UTSW 14 34398034 missense probably damaging 0.97
R0499:Mmrn2 UTSW 14 34397956 missense probably damaging 1.00
R1073:Mmrn2 UTSW 14 34396294 critical splice donor site probably null
R1422:Mmrn2 UTSW 14 34396239 missense probably damaging 1.00
R1455:Mmrn2 UTSW 14 34399132 missense probably benign 0.00
R1584:Mmrn2 UTSW 14 34375685 missense probably benign 0.19
R1702:Mmrn2 UTSW 14 34397914 missense probably benign 0.34
R1919:Mmrn2 UTSW 14 34397643 missense probably benign 0.10
R1961:Mmrn2 UTSW 14 34398475 unclassified probably null
R2267:Mmrn2 UTSW 14 34399492 missense probably benign 0.41
R2268:Mmrn2 UTSW 14 34399492 missense probably benign 0.41
R2516:Mmrn2 UTSW 14 34398802 missense probably benign 0.12
R2571:Mmrn2 UTSW 14 34402939 missense probably damaging 0.99
R2696:Mmrn2 UTSW 14 34398415 missense probably damaging 1.00
R2892:Mmrn2 UTSW 14 34396630 missense probably benign 0.01
R2919:Mmrn2 UTSW 14 34402922 missense possibly damaging 0.72
R3611:Mmrn2 UTSW 14 34398675 missense probably benign 0.00
R3898:Mmrn2 UTSW 14 34399560 unclassified probably null
R3899:Mmrn2 UTSW 14 34399560 unclassified probably null
R3900:Mmrn2 UTSW 14 34399560 unclassified probably null
R4363:Mmrn2 UTSW 14 34397977 missense probably damaging 0.99
R4392:Mmrn2 UTSW 14 34397616 missense probably damaging 1.00
R4510:Mmrn2 UTSW 14 34403059 missense possibly damaging 0.67
R4511:Mmrn2 UTSW 14 34403059 missense possibly damaging 0.67
R4993:Mmrn2 UTSW 14 34396398 missense probably damaging 1.00
R5026:Mmrn2 UTSW 14 34399201 missense probably benign 0.07
R5263:Mmrn2 UTSW 14 34399584 missense probably benign
R5478:Mmrn2 UTSW 14 34396582 missense probably benign 0.11
R6059:Mmrn2 UTSW 14 34397591 nonsense probably null
R6279:Mmrn2 UTSW 14 34397657 missense probably benign
R6300:Mmrn2 UTSW 14 34397657 missense probably benign
R6938:Mmrn2 UTSW 14 34398714 missense probably benign 0.22
R7491:Mmrn2 UTSW 14 34399417 missense probably damaging 1.00
R7607:Mmrn2 UTSW 14 34398940 missense possibly damaging 0.58
X0064:Mmrn2 UTSW 14 34399152 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTAAGGGCTTCTACATTCC -3'
(R):5'- TCTGCAACAGATACCATGTTTCAG -3'

Sequencing Primer
(F):5'- AAGGGCTTCTACATTCCAGCTTAGG -3'
(R):5'- GTTTCAGAAAAGCCTGCTGC -3'
Posted On2016-10-26