Incidental Mutation 'R5606:Tlr11'
ID439310
Institutional Source Beutler Lab
Gene Symbol Tlr11
Ensembl Gene ENSMUSG00000051969
Gene Nametoll-like receptor 11
SynonymsLOC239081
MMRRC Submission 043157-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5606 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50357914-50363663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50362260 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 568 (C568R)
Ref Sequence ENSEMBL: ENSMUSP00000138814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063570] [ENSMUST00000185091]
Predicted Effect probably benign
Transcript: ENSMUST00000063570
AA Change: C563R

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000068906
Gene: ENSMUSG00000051969
AA Change: C563R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 105 122 N/A INTRINSIC
low complexity region 153 161 N/A INTRINSIC
LRR 311 333 3.36e1 SMART
LRR 335 361 4.44e0 SMART
LRR 362 383 2.03e1 SMART
LRR_TYP 384 407 2.57e-3 SMART
LRR_TYP 408 431 2.75e-3 SMART
low complexity region 544 556 N/A INTRINSIC
LRR 605 628 6.06e1 SMART
transmembrane domain 719 741 N/A INTRINSIC
Pfam:TIR 773 922 2.1e-9 PFAM
Pfam:TIR_2 776 894 6.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185091
AA Change: C568R

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138814
Gene: ENSMUSG00000051969
AA Change: C568R

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
low complexity region 110 127 N/A INTRINSIC
low complexity region 158 166 N/A INTRINSIC
Pfam:LRR_6 221 244 5.3e-2 PFAM
LRR 316 338 3.36e1 SMART
LRR 340 366 4.44e0 SMART
LRR 367 388 2.03e1 SMART
LRR_TYP 389 412 2.57e-3 SMART
LRR_TYP 413 436 2.75e-3 SMART
low complexity region 549 561 N/A INTRINSIC
LRR 610 633 6.06e1 SMART
transmembrane domain 724 746 N/A INTRINSIC
Pfam:TIR_2 781 898 1e-12 PFAM
Pfam:TIR 781 922 1.8e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a7 A G 19: 20,722,367 S75P probably damaging Het
Ankib1 A T 5: 3,701,907 I711N probably damaging Het
Ankmy2 A G 12: 36,165,921 N40S probably benign Het
Armc8 T C 9: 99,536,262 K80E probably benign Het
BC005561 T C 5: 104,521,878 I1422T probably benign Het
Blm C A 7: 80,460,832 probably null Het
Cand1 C A 10: 119,211,454 Q710H possibly damaging Het
Ckap2l A T 2: 129,286,039 I73N probably damaging Het
Ddx27 T A 2: 167,019,966 D129E probably benign Het
Dnm3 T C 1: 162,286,018 E491G probably damaging Het
Fgd6 C A 10: 94,138,328 Y1310* probably null Het
Gm7534 A C 4: 134,200,212 V410G probably benign Het
Hnrnph3 C T 10: 63,019,443 R21H possibly damaging Het
Hs3st4 C A 7: 124,397,142 Q344K probably damaging Het
Hyal3 T C 9: 107,585,066 S100P probably benign Het
Map3k19 G A 1: 127,822,957 R886C probably benign Het
Mmrn2 G A 14: 34,397,624 D187N probably damaging Het
Myo5c G A 9: 75,275,508 A810T probably damaging Het
Noxa1 T A 2: 25,086,280 E332V possibly damaging Het
Olfr129 T C 17: 38,054,802 T264A probably damaging Het
Olfr1356 A G 10: 78,847,561 M118T probably benign Het
Olfr536 T A 7: 140,503,800 I220F probably damaging Het
Olfr550 T C 7: 102,579,274 S260P probably damaging Het
Parg T A 14: 32,262,736 V241E probably damaging Het
Pitrm1 T A 13: 6,560,065 V391D probably damaging Het
Plch1 A T 3: 63,740,687 V421E probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Spta1 A T 1: 174,219,902 H1704L probably damaging Het
Tbpl2 G A 2: 24,087,233 P258S possibly damaging Het
Tmem260 T A 14: 48,484,980 M324K probably damaging Het
Tmprss11g T A 5: 86,487,410 T402S probably damaging Het
Trim21 C G 7: 102,559,606 R302P probably damaging Het
Uox T A 3: 146,610,302 Y21* probably null Het
Vmn1r74 A G 7: 11,846,895 M41V probably benign Het
Vmn2r59 A C 7: 42,045,894 S365A probably benign Het
Zfp345 A T 2: 150,474,868 Y6* probably null Het
Other mutations in Tlr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Tlr11 APN 14 50360916 missense probably benign
IGL02090:Tlr11 APN 14 50363032 missense probably damaging 0.99
IGL02286:Tlr11 APN 14 50360871 missense possibly damaging 0.91
IGL02671:Tlr11 APN 14 50360692 missense probably damaging 1.00
IGL03064:Tlr11 APN 14 50361100 missense probably damaging 1.00
IGL03068:Tlr11 APN 14 50361484 missense probably benign
R0099:Tlr11 UTSW 14 50360818 missense probably benign 0.14
R0727:Tlr11 UTSW 14 50361469 missense possibly damaging 0.67
R0944:Tlr11 UTSW 14 50362336 missense probably benign 0.12
R1490:Tlr11 UTSW 14 50363176 missense probably benign 0.00
R1726:Tlr11 UTSW 14 50361541 missense probably benign 0.00
R1803:Tlr11 UTSW 14 50360647 missense probably benign 0.00
R1908:Tlr11 UTSW 14 50361207 missense probably benign 0.00
R1971:Tlr11 UTSW 14 50361234 missense probably benign
R1981:Tlr11 UTSW 14 50361988 missense possibly damaging 0.95
R2023:Tlr11 UTSW 14 50362569 missense probably damaging 0.96
R2079:Tlr11 UTSW 14 50360980 missense probably damaging 0.99
R2155:Tlr11 UTSW 14 50360682 missense probably benign 0.01
R2251:Tlr11 UTSW 14 50360792 missense probably benign 0.02
R3017:Tlr11 UTSW 14 50362721 nonsense probably null
R3760:Tlr11 UTSW 14 50362243 missense probably damaging 1.00
R3876:Tlr11 UTSW 14 50363154 missense probably benign
R3936:Tlr11 UTSW 14 50362735 missense possibly damaging 0.78
R4002:Tlr11 UTSW 14 50362527 missense probably benign
R4024:Tlr11 UTSW 14 50362846 missense probably benign 0.02
R4118:Tlr11 UTSW 14 50363227 missense probably damaging 1.00
R4222:Tlr11 UTSW 14 50361849 missense probably damaging 0.99
R4365:Tlr11 UTSW 14 50361469 missense probably damaging 0.98
R4678:Tlr11 UTSW 14 50360982 missense possibly damaging 0.85
R4779:Tlr11 UTSW 14 50361250 missense possibly damaging 0.76
R4910:Tlr11 UTSW 14 50362889 missense probably benign 0.45
R4921:Tlr11 UTSW 14 50362885 missense possibly damaging 0.48
R5114:Tlr11 UTSW 14 50363121 missense possibly damaging 0.81
R5126:Tlr11 UTSW 14 50360830 missense probably damaging 1.00
R5349:Tlr11 UTSW 14 50360880 missense probably benign 0.45
R5650:Tlr11 UTSW 14 50361201 missense probably benign 0.03
R5958:Tlr11 UTSW 14 50360777 missense probably damaging 0.99
R5966:Tlr11 UTSW 14 50362255 missense probably benign 0.02
R6480:Tlr11 UTSW 14 50363055 missense possibly damaging 0.62
R6484:Tlr11 UTSW 14 50362678 missense probably damaging 0.99
R6679:Tlr11 UTSW 14 50362854 missense probably benign 0.00
R6717:Tlr11 UTSW 14 50362104 missense probably benign
R7085:Tlr11 UTSW 14 50362656 missense probably damaging 0.99
R7241:Tlr11 UTSW 14 50362141 missense possibly damaging 0.95
R7440:Tlr11 UTSW 14 50361344 missense probably benign 0.00
R7482:Tlr11 UTSW 14 50362999 missense probably damaging 0.99
R7582:Tlr11 UTSW 14 50361729 nonsense probably null
Z1088:Tlr11 UTSW 14 50362338 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGGAGAACCTTACCTTAGAGACTTC -3'
(R):5'- AAGAGCAGCAGTTTGAGGTC -3'

Sequencing Primer
(F):5'- GAACCTTACCTTAGAGACTTCCATTC -3'
(R):5'- TGAGGTCCTGCAAGCTCTTAAAG -3'
Posted On2016-10-26