Incidental Mutation 'R5606:Aldh1a7'
ID439313
Institutional Source Beutler Lab
Gene Symbol Aldh1a7
Ensembl Gene ENSMUSG00000024747
Gene Namealdehyde dehydrogenase family 1, subfamily A7
SynonymsAldh-pb, Ahd2-like
MMRRC Submission 043157-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R5606 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location20692953-20727562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20722367 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 75 (S75P)
Ref Sequence ENSEMBL: ENSMUSP00000025656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025656]
Predicted Effect probably damaging
Transcript: ENSMUST00000025656
AA Change: S75P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025656
Gene: ENSMUSG00000024747
AA Change: S75P

DomainStartEndE-ValueType
Pfam:Aldedh 29 492 2.5e-185 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankib1 A T 5: 3,701,907 I711N probably damaging Het
Ankmy2 A G 12: 36,165,921 N40S probably benign Het
Armc8 T C 9: 99,536,262 K80E probably benign Het
BC005561 T C 5: 104,521,878 I1422T probably benign Het
Blm C A 7: 80,460,832 probably null Het
Cand1 C A 10: 119,211,454 Q710H possibly damaging Het
Ckap2l A T 2: 129,286,039 I73N probably damaging Het
Ddx27 T A 2: 167,019,966 D129E probably benign Het
Dnm3 T C 1: 162,286,018 E491G probably damaging Het
Fgd6 C A 10: 94,138,328 Y1310* probably null Het
Gm7534 A C 4: 134,200,212 V410G probably benign Het
Hnrnph3 C T 10: 63,019,443 R21H possibly damaging Het
Hs3st4 C A 7: 124,397,142 Q344K probably damaging Het
Hyal3 T C 9: 107,585,066 S100P probably benign Het
Map3k19 G A 1: 127,822,957 R886C probably benign Het
Mmrn2 G A 14: 34,397,624 D187N probably damaging Het
Myo5c G A 9: 75,275,508 A810T probably damaging Het
Noxa1 T A 2: 25,086,280 E332V possibly damaging Het
Olfr129 T C 17: 38,054,802 T264A probably damaging Het
Olfr1356 A G 10: 78,847,561 M118T probably benign Het
Olfr536 T A 7: 140,503,800 I220F probably damaging Het
Olfr550 T C 7: 102,579,274 S260P probably damaging Het
Parg T A 14: 32,262,736 V241E probably damaging Het
Pitrm1 T A 13: 6,560,065 V391D probably damaging Het
Plch1 A T 3: 63,740,687 V421E probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Spta1 A T 1: 174,219,902 H1704L probably damaging Het
Tbpl2 G A 2: 24,087,233 P258S possibly damaging Het
Tlr11 T C 14: 50,362,260 C568R probably benign Het
Tmem260 T A 14: 48,484,980 M324K probably damaging Het
Tmprss11g T A 5: 86,487,410 T402S probably damaging Het
Trim21 C G 7: 102,559,606 R302P probably damaging Het
Uox T A 3: 146,610,302 Y21* probably null Het
Vmn1r74 A G 7: 11,846,895 M41V probably benign Het
Vmn2r59 A C 7: 42,045,894 S365A probably benign Het
Zfp345 A T 2: 150,474,868 Y6* probably null Het
Other mutations in Aldh1a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Aldh1a7 APN 19 20700046 missense probably damaging 1.00
IGL01132:Aldh1a7 APN 19 20727040 missense possibly damaging 0.76
IGL01630:Aldh1a7 APN 19 20696329 splice site probably benign
IGL01901:Aldh1a7 APN 19 20717739 missense probably damaging 0.99
IGL02324:Aldh1a7 APN 19 20727004 missense probably damaging 1.00
IGL02822:Aldh1a7 APN 19 20702266 missense possibly damaging 0.85
IGL03162:Aldh1a7 APN 19 20708281 missense probably benign 0.21
PIT4514001:Aldh1a7 UTSW 19 20702240 missense probably benign 0.07
R0125:Aldh1a7 UTSW 19 20727066 splice site probably benign
R0268:Aldh1a7 UTSW 19 20709502 critical splice acceptor site probably null
R0833:Aldh1a7 UTSW 19 20702243 missense probably damaging 1.00
R1665:Aldh1a7 UTSW 19 20727461 missense probably benign
R1709:Aldh1a7 UTSW 19 20715952 missense probably damaging 1.00
R1772:Aldh1a7 UTSW 19 20716019 missense probably damaging 1.00
R1917:Aldh1a7 UTSW 19 20727455 missense probably benign
R2570:Aldh1a7 UTSW 19 20699956 missense probably benign 0.35
R3778:Aldh1a7 UTSW 19 20719311 missense possibly damaging 0.70
R3832:Aldh1a7 UTSW 19 20708238 missense probably damaging 1.00
R3894:Aldh1a7 UTSW 19 20696398 nonsense probably null
R4601:Aldh1a7 UTSW 19 20715979 missense probably damaging 0.98
R4948:Aldh1a7 UTSW 19 20727010 missense possibly damaging 0.77
R5562:Aldh1a7 UTSW 19 20702264 nonsense probably null
R5641:Aldh1a7 UTSW 19 20715929 missense probably benign 0.00
R5808:Aldh1a7 UTSW 19 20708197 missense possibly damaging 0.79
R6646:Aldh1a7 UTSW 19 20699911 missense possibly damaging 0.94
R6759:Aldh1a7 UTSW 19 20699956 missense possibly damaging 0.89
R7034:Aldh1a7 UTSW 19 20708178 missense possibly damaging 0.95
R7036:Aldh1a7 UTSW 19 20708178 missense possibly damaging 0.95
R7150:Aldh1a7 UTSW 19 20716018 missense probably damaging 1.00
R7255:Aldh1a7 UTSW 19 20714728 missense probably damaging 1.00
R7875:Aldh1a7 UTSW 19 20715979 missense possibly damaging 0.90
R7958:Aldh1a7 UTSW 19 20715979 missense possibly damaging 0.90
X0022:Aldh1a7 UTSW 19 20719315 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGACTCTGAGAAGTTCTAGAG -3'
(R):5'- ACATACTACAGTGAGGTATGGCG -3'

Sequencing Primer
(F):5'- CAGGAGGAAGTTTGTCATTGTACTC -3'
(R):5'- ATGGCGGCTTGGCTTCTC -3'
Posted On2016-10-26