Incidental Mutation 'R5607:Bmpr1b'
ID439325
Institutional Source Beutler Lab
Gene Symbol Bmpr1b
Ensembl Gene ENSMUSG00000052430
Gene Namebone morphogenetic protein receptor, type 1B
SynonymsBMPR-IB, Alk6, Acvrlk6, CFK-43a
MMRRC Submission 043271-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R5607 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location141837136-142169425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 141857522 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 220 (M220I)
Ref Sequence ENSEMBL: ENSMUSP00000101839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029948] [ENSMUST00000098568] [ENSMUST00000106230] [ENSMUST00000106232] [ENSMUST00000131273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029948
AA Change: M220I

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029948
Gene: ENSMUSG00000052430
AA Change: M220I

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000098568
AA Change: M220I

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096167
Gene: ENSMUSG00000052430
AA Change: M220I

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000106230
AA Change: M220I

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101837
Gene: ENSMUSG00000052430
AA Change: M220I

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000106232
AA Change: M220I

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101839
Gene: ENSMUSG00000052430
AA Change: M220I

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131273
SMART Domains Protein: ENSMUSP00000117478
Gene: ENSMUSG00000052430

DomainStartEndE-ValueType
PDB:3EVS|C 13 47 1e-18 PDB
SCOP:d1es7b_ 28 47 2e-4 SMART
Meta Mutation Damage Score 0.1051 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: This gene encodes a serine/threonine kinase that functions as a receptor for bone morphogenetic proteins (BMPs). The encoded protein is a type I receptor, and forms a complex of two type II and two type I receptors at the cell membrane. This complex signals downstream to activate SMAD transcriptional regulators. This signaling is important in skeletal and bone development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mutantions of this gene affect the shape of the distal limb skeleton resulting in brachydactyly or failure to generate digit cartilage. Furthermore, inactivation results in female sterility due to abnormal oestrus cyclicity as well as retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,937,257 G1118W probably damaging Het
Ajap1 T A 4: 153,432,204 T227S possibly damaging Het
Ankmy1 A G 1: 92,877,018 F851S probably damaging Het
Blvrb C T 7: 27,459,469 P98L probably benign Het
Cacna1e T A 1: 154,471,340 N1027I probably benign Het
Cacng4 A T 11: 107,734,784 V327E probably damaging Het
Casp1 T C 9: 5,303,143 V199A probably damaging Het
Cdh13 A T 8: 118,757,474 D158V probably benign Het
Cenpe C A 3: 135,235,076 S662* probably null Het
Ctnna1 A G 18: 35,249,742 D647G probably benign Het
Dennd5a C A 7: 109,919,423 E480* probably null Het
Exoc6 T A 19: 37,578,529 V258D probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G A 1: 174,609,811 C1116Y probably damaging Het
H2-Aa T C 17: 34,283,842 T117A possibly damaging Het
Ktn1 TTGTTGTCTTTGTGTT TTGTT 14: 47,734,097 probably benign Het
Lig1 C A 7: 13,306,008 T715N probably damaging Het
Lrrc31 C A 3: 30,689,845 probably null Het
Mcm6 T C 1: 128,355,589 T60A probably damaging Het
Mex3c T A 18: 73,589,943 M369K possibly damaging Het
Mmp14 T C 14: 54,439,412 Y428H probably damaging Het
Msh6 A G 17: 87,986,901 D1028G probably damaging Het
Myo9a T C 9: 59,863,944 V933A probably damaging Het
Nepn A T 10: 52,401,137 D323V probably benign Het
Nrf1 C T 6: 30,126,246 A150V probably damaging Het
Nxpe5 A G 5: 138,239,771 T199A probably benign Het
Obscn T G 11: 59,122,848 K1150Q probably benign Het
Olfr1354 A G 10: 78,917,099 I86M possibly damaging Het
Olfr536 A C 7: 140,504,405 V18G probably benign Het
Olfr591 T C 7: 103,172,849 T263A probably damaging Het
Olfr617 G A 7: 103,584,299 W92* probably null Het
Olfr862 T A 9: 19,883,976 M110L probably benign Het
Otop1 G A 5: 38,294,504 G184S possibly damaging Het
Pkp2 G T 16: 16,260,375 D494Y probably damaging Het
Pop5 G A 5: 115,240,201 R68Q probably damaging Het
Ppp1r13b T C 12: 111,833,789 D518G probably benign Het
Preb G T 5: 30,959,963 probably benign Het
Qrfpr A G 3: 36,180,965 V292A possibly damaging Het
Rag1 G A 2: 101,643,792 T335I probably damaging Het
Rbbp6 T A 7: 122,997,086 V617E probably damaging Het
Sf3a3 A T 4: 124,714,953 D20V probably damaging Het
Slco1b2 A G 6: 141,685,586 N649D probably benign Het
Smarcal1 A G 1: 72,586,213 D173G probably benign Het
Smg7 A G 1: 152,843,234 L914P probably damaging Het
Tbc1d32 A T 10: 56,129,150 S796T possibly damaging Het
Tex14 A G 11: 87,522,578 T1052A probably benign Het
Tspan1 A G 4: 116,164,080 V109A possibly damaging Het
Ttbk2 A G 2: 120,806,824 V51A possibly damaging Het
Tubgcp6 A G 15: 89,111,150 V419A probably benign Het
Ubr2 G T 17: 46,934,200 C1633* probably null Het
Uggt2 C T 14: 119,089,199 G200D possibly damaging Het
Vmn2r25 T C 6: 123,828,359 E513G possibly damaging Het
Zscan22 G A 7: 12,906,992 G388S probably damaging Het
Other mutations in Bmpr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Bmpr1b APN 3 141871338 missense probably damaging 1.00
IGL01394:Bmpr1b APN 3 141862981 critical splice donor site probably null
IGL02078:Bmpr1b APN 3 141870737 missense possibly damaging 0.63
IGL02315:Bmpr1b APN 3 141857529 missense probably damaging 1.00
IGL02600:Bmpr1b APN 3 141840727 missense probably damaging 1.00
IGL02709:Bmpr1b APN 3 141856553 missense probably damaging 1.00
IGL02972:Bmpr1b APN 3 141870758 missense probably benign 0.00
IGL03305:Bmpr1b APN 3 141843024 splice site probably benign
PIT4366001:Bmpr1b UTSW 3 141880463 missense probably benign
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0463:Bmpr1b UTSW 3 141857430 missense possibly damaging 0.53
R0880:Bmpr1b UTSW 3 141870796 nonsense probably null
R1449:Bmpr1b UTSW 3 141871373 missense possibly damaging 0.79
R1815:Bmpr1b UTSW 3 141880363 missense probably benign 0.03
R1852:Bmpr1b UTSW 3 141857402 critical splice donor site probably null
R1971:Bmpr1b UTSW 3 141857572 missense probably damaging 1.00
R2064:Bmpr1b UTSW 3 141870807 missense probably benign 0.00
R2299:Bmpr1b UTSW 3 141845202 missense probably damaging 1.00
R2912:Bmpr1b UTSW 3 141880378 missense probably benign 0.00
R4899:Bmpr1b UTSW 3 141840683 missense probably damaging 1.00
R4960:Bmpr1b UTSW 3 141870785 missense probably damaging 1.00
R4970:Bmpr1b UTSW 3 141845187 missense probably damaging 1.00
R5331:Bmpr1b UTSW 3 141856415 missense probably damaging 1.00
R5608:Bmpr1b UTSW 3 141857522 missense possibly damaging 0.70
R5829:Bmpr1b UTSW 3 141845157 missense probably benign 0.00
R5855:Bmpr1b UTSW 3 141871385 missense possibly damaging 0.76
R5933:Bmpr1b UTSW 3 141871367 makesense probably null
R6310:Bmpr1b UTSW 3 141864536 missense probably damaging 0.97
R6469:Bmpr1b UTSW 3 141856461 missense possibly damaging 0.95
R6826:Bmpr1b UTSW 3 141857406 missense probably damaging 1.00
R7167:Bmpr1b UTSW 3 141863080 missense probably benign 0.03
R7526:Bmpr1b UTSW 3 141856599 missense probably damaging 1.00
R8136:Bmpr1b UTSW 3 141856382 missense probably damaging 1.00
R8518:Bmpr1b UTSW 3 141857582 missense possibly damaging 0.95
Z1176:Bmpr1b UTSW 3 141842954 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGATGAGTTCATATGCAGATGTGC -3'
(R):5'- CACGTTGGTCTATCAAGTAGGAG -3'

Sequencing Primer
(F):5'- CAGATGTGCAGAGGAAGACAG -3'
(R):5'- TTTGGGTCTTACCAGGTC -3'
Posted On2016-10-26