Incidental Mutation 'R0496:Jak3'
ID43933
Institutional Source Beutler Lab
Gene Symbol Jak3
Ensembl Gene ENSMUSG00000031805
Gene NameJanus kinase 3
Synonymsfae; wil
MMRRC Submission 038692-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R0496 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71676296-71690575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71682397 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 558 (H558L)
Ref Sequence ENSEMBL: ENSMUSP00000105640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051995] [ENSMUST00000110012] [ENSMUST00000110013]
Predicted Effect probably damaging
Transcript: ENSMUST00000051995
AA Change: H558L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060073
Gene: ENSMUSG00000031805
AA Change: H558L

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110012
AA Change: H558L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105639
Gene: ENSMUSG00000031805
AA Change: H558L

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110013
AA Change: H558L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105640
Gene: ENSMUSG00000031805
AA Change: H558L

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133263
Meta Mutation Damage Score 0.6217 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,244 K1065E probably damaging Het
4932438A13Rik A G 3: 36,987,635 T2721A probably damaging Het
4933402N03Rik T C 7: 131,146,131 N44S probably benign Het
Abca13 A G 11: 9,291,701 D1188G probably benign Het
Abcb11 C T 2: 69,277,884 probably benign Het
Abcc8 A T 7: 46,108,820 I1274N probably damaging Het
Adamtsl1 G A 4: 86,341,198 C827Y probably damaging Het
Agap3 T A 5: 24,501,243 V369E probably damaging Het
Ankrd13b G A 11: 77,473,041 R195C probably damaging Het
Ap3b1 A G 13: 94,472,938 probably benign Het
Arhgef40 A T 14: 52,004,907 probably benign Het
Atad5 A G 11: 80,100,356 I692V probably benign Het
Atp5b G T 10: 128,086,174 R310L possibly damaging Het
AY358078 A T 14: 51,803,532 M103L unknown Het
Bcl9l T G 9: 44,509,518 V1370G probably benign Het
Bglap3 T A 3: 88,369,137 Q38L probably damaging Het
Cd38 T C 5: 43,868,891 F6L probably damaging Het
Cela3a A C 4: 137,404,468 V138G probably damaging Het
Clvs1 T A 4: 9,424,241 I229N probably damaging Het
Cpne1 G A 2: 156,079,419 H16Y probably damaging Het
Ctc1 T C 11: 69,035,507 L1069P probably damaging Het
Ctgf G T 10: 24,597,515 M317I possibly damaging Het
Dgkd G A 1: 87,936,900 S996N probably null Het
Dnah9 A T 11: 66,075,135 M1685K probably null Het
Dnajb12 C T 10: 59,879,801 R42* probably null Het
Dock5 T C 14: 67,817,518 Q633R probably damaging Het
Dync2h1 A G 9: 7,155,180 M868T probably benign Het
Enpp1 G T 10: 24,672,052 H208Q probably benign Het
Epha7 T A 4: 28,821,292 D152E probably damaging Het
Fancd2 T C 6: 113,555,130 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gm10964 A T 3: 103,739,429 probably null Het
Gm7075 G T 10: 63,421,602 C46* probably null Het
Gpbar1 T C 1: 74,278,981 F128L probably benign Het
Gsx2 T A 5: 75,077,065 M226K probably benign Het
Gucd1 T C 10: 75,511,266 D50G possibly damaging Het
Has1 A G 17: 17,843,746 Y544H probably benign Het
Hc A T 2: 35,013,571 Y1024N probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ift122 T A 6: 115,905,902 H659Q probably benign Het
Itga2 T C 13: 114,853,899 Q902R probably benign Het
Itgb2l T C 16: 96,434,701 K181E possibly damaging Het
Kcnh8 A G 17: 52,725,858 T58A probably benign Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt33a C T 11: 100,012,329 probably benign Het
Magi2 A T 5: 20,661,359 probably benign Het
Map4 G A 9: 110,039,850 probably benign Het
Map4k4 T A 1: 40,006,822 S754T probably damaging Het
Mapk8ip3 A G 17: 24,914,450 probably benign Het
Mib1 A G 18: 10,804,773 S918G probably benign Het
Mipol1 T A 12: 57,457,177 V377D probably damaging Het
Mlh1 T C 9: 111,241,556 T364A probably benign Het
Mta1 C T 12: 113,131,321 Q400* probably null Het
Mthfd1l C G 10: 4,090,006 R806G probably benign Het
Myh13 C A 11: 67,348,815 N730K probably damaging Het
Myom1 A G 17: 71,084,306 K937E probably damaging Het
Naxd T C 8: 11,510,224 probably benign Het
Negr1 G T 3: 157,016,267 K159N probably damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1170 A T 2: 88,224,155 Y292* probably null Het
Olfr137 A G 17: 38,304,658 S268P probably damaging Het
Olfr397 T C 11: 73,964,880 S91P probably benign Het
Olfr584 T C 7: 103,085,590 I19T probably damaging Het
Olfr620 C T 7: 103,611,997 A119T probably benign Het
Pcsk6 G A 7: 65,927,249 S58N probably benign Het
Pdzrn3 G A 6: 101,150,570 T1045I possibly damaging Het
Pitrm1 T C 13: 6,568,714 L641P probably damaging Het
Pkd1l1 G T 11: 8,929,430 H474N probably damaging Het
Pltp A G 2: 164,852,461 probably benign Het
Qtrt1 C T 9: 21,419,548 T324M probably benign Het
Racgap1 A T 15: 99,639,832 probably benign Het
Rhbg A G 3: 88,254,498 V50A probably benign Het
Rnf135 G A 11: 80,183,950 V12M probably damaging Het
Rufy2 T C 10: 62,993,170 V117A probably damaging Het
Safb A G 17: 56,605,630 M866V probably benign Het
Slc35c2 G T 2: 165,280,815 T183K probably damaging Het
Slc39a7 A G 17: 34,029,538 L377P probably damaging Het
Slit1 G A 19: 41,608,311 probably benign Het
Spaca9 G A 2: 28,693,010 H133Y probably damaging Het
Spout1 A G 2: 30,174,971 F339S probably benign Het
St6gal2 A G 17: 55,482,014 I16M probably damaging Het
Stat2 T C 10: 128,276,509 M6T probably benign Het
Swt1 T A 1: 151,411,270 H157L probably benign Het
Syne2 A G 12: 76,038,940 N147D possibly damaging Het
Tmem2 A T 19: 21,797,345 N117I possibly damaging Het
Tmem222 A T 4: 133,277,591 M45K possibly damaging Het
Tmem30a T A 9: 79,777,285 H95L probably damaging Het
Tns3 A C 11: 8,547,262 probably benign Het
Trpm3 A G 19: 22,698,778 I103V probably benign Het
Ube2n T C 10: 95,541,344 F57S probably benign Het
Vil1 T C 1: 74,421,340 S219P possibly damaging Het
Wdfy4 A G 14: 33,140,738 probably benign Het
Wdr7 T C 18: 63,791,843 S966P probably benign Het
Wnt8a A G 18: 34,544,847 N103D probably damaging Het
Zfp523 G A 17: 28,200,445 E186K possibly damaging Het
Zfp791 A T 8: 85,109,980 D418E probably benign Het
Zscan20 A G 4: 128,591,889 V192A probably benign Het
Other mutations in Jak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Jak3 APN 8 71681697 splice site probably benign
IGL00720:Jak3 APN 8 71684037 missense probably damaging 1.00
IGL00966:Jak3 APN 8 71679012 missense probably benign 0.24
IGL01147:Jak3 APN 8 71683403 missense probably benign
IGL01308:Jak3 APN 8 71685166 missense probably damaging 1.00
IGL01328:Jak3 APN 8 71679620 missense probably damaging 1.00
IGL01386:Jak3 APN 8 71684289 missense probably damaging 1.00
IGL01515:Jak3 APN 8 71680562 splice site probably null
IGL01870:Jak3 APN 8 71680790 missense probably damaging 1.00
IGL02132:Jak3 APN 8 71678480 missense probably damaging 0.99
IGL02413:Jak3 APN 8 71686119 unclassified probably null
IGL02752:Jak3 APN 8 71682951 missense possibly damaging 0.50
IGL03089:Jak3 APN 8 71686083 missense probably benign 0.15
IGL03177:Jak3 APN 8 71682370 missense probably damaging 1.00
citron UTSW 8 71686976 splice site probably benign
daniels UTSW 8 71681655 missense possibly damaging 0.48
Deposuit UTSW 8 71685404 missense probably damaging 1.00
distortion UTSW 8 71683978 missense probably damaging 1.00
Downcast UTSW 8 71685511 missense probably benign 0.07
fake_news UTSW 8 71685957 missense probably damaging 1.00
Implevit UTSW 8 71678773 missense probably benign
mount_tai UTSW 8 71683377 missense probably damaging 1.00
potentes UTSW 8 71686058 missense probably damaging 0.99
thistle UTSW 8 71685383 critical splice acceptor site probably null
thistle2 UTSW 8 71685545 missense probably damaging 1.00
PIT4403001:Jak3 UTSW 8 71684349 missense probably benign 0.00
PIT4515001:Jak3 UTSW 8 71679642 missense probably benign 0.21
R0013:Jak3 UTSW 8 71684327 missense probably damaging 0.98
R0522:Jak3 UTSW 8 71682274 splice site probably benign
R0531:Jak3 UTSW 8 71686976 splice site probably benign
R0538:Jak3 UTSW 8 71685482 missense probably benign
R0612:Jak3 UTSW 8 71683377 missense probably damaging 1.00
R0744:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0833:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0836:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R1183:Jak3 UTSW 8 71684550 missense probably damaging 1.00
R1420:Jak3 UTSW 8 71681538 missense possibly damaging 0.75
R1793:Jak3 UTSW 8 71685946 splice site probably benign
R1967:Jak3 UTSW 8 71681535 missense probably damaging 1.00
R1983:Jak3 UTSW 8 71678375 missense possibly damaging 0.95
R1983:Jak3 UTSW 8 71688136 missense probably benign
R2058:Jak3 UTSW 8 71685383 critical splice acceptor site probably null
R2060:Jak3 UTSW 8 71680714 nonsense probably null
R2060:Jak3 UTSW 8 71683415 nonsense probably null
R3705:Jak3 UTSW 8 71681522 missense probably damaging 1.00
R3734:Jak3 UTSW 8 71676581 unclassified probably benign
R4231:Jak3 UTSW 8 71685545 missense probably damaging 1.00
R4596:Jak3 UTSW 8 71684631 missense probably damaging 0.99
R4844:Jak3 UTSW 8 71681655 missense possibly damaging 0.48
R4897:Jak3 UTSW 8 71685404 missense probably damaging 1.00
R5038:Jak3 UTSW 8 71686058 missense probably damaging 0.99
R5469:Jak3 UTSW 8 71678773 missense probably benign
R5538:Jak3 UTSW 8 71678773 missense probably benign
R5718:Jak3 UTSW 8 71684354 missense probably damaging 1.00
R5799:Jak3 UTSW 8 71678700 missense probably damaging 1.00
R5909:Jak3 UTSW 8 71684231 missense possibly damaging 0.68
R5959:Jak3 UTSW 8 71682071 missense probably damaging 1.00
R6260:Jak3 UTSW 8 71679310 missense probably benign 0.00
R6798:Jak3 UTSW 8 71680971 missense probably damaging 0.99
R7013:Jak3 UTSW 8 71678781 missense possibly damaging 0.88
R7070:Jak3 UTSW 8 71684611 missense probably damaging 1.00
R7122:Jak3 UTSW 8 71685957 missense probably damaging 1.00
R7166:Jak3 UTSW 8 71682316 missense probably damaging 1.00
R7225:Jak3 UTSW 8 71685511 missense probably benign 0.07
R7440:Jak3 UTSW 8 71680718 missense probably benign 0.02
R7489:Jak3 UTSW 8 71684292 missense probably damaging 1.00
R7773:Jak3 UTSW 8 71679042 missense probably benign
R7779:Jak3 UTSW 8 71687288 missense probably benign 0.01
Z1176:Jak3 UTSW 8 71680683 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGAAGCCACCTTCAACTGTCCTC -3'
(R):5'- TTGGCCTTACAGATGTCATGCTCAC -3'

Sequencing Primer
(F):5'- CAACTGTCCTCGCCTGG -3'
(R):5'- gagagagagagagagagagagag -3'
Posted On2013-05-29