Incidental Mutation 'R5607:Olfr617'
ID 439339
Institutional Source Beutler Lab
Gene Symbol Olfr617
Ensembl Gene ENSMUSG00000073946
Gene Name olfactory receptor 617
Synonyms GA_x6K02T2PBJ9-6306819-6307775, MOR31-10
MMRRC Submission 043271-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R5607 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103573061-103586795 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 103584299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 92 (W92*)
Ref Sequence ENSEMBL: ENSMUSP00000149045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048265] [ENSMUST00000215755] [ENSMUST00000216516]
AlphaFold Q8VGA1
Predicted Effect probably null
Transcript: ENSMUST00000048265
AA Change: W92*
SMART Domains Protein: ENSMUSP00000040319
Gene: ENSMUSG00000073946
AA Change: W92*

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 8.5e-109 PFAM
Pfam:7TM_GPCR_Srsx 41 225 2.3e-10 PFAM
Pfam:7tm_1 47 299 4.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179692
Predicted Effect probably null
Transcript: ENSMUST00000215755
AA Change: W92*
Predicted Effect probably null
Transcript: ENSMUST00000216516
AA Change: W92*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,937,257 G1118W probably damaging Het
Ajap1 T A 4: 153,432,204 T227S possibly damaging Het
Ankmy1 A G 1: 92,877,018 F851S probably damaging Het
Blvrb C T 7: 27,459,469 P98L probably benign Het
Bmpr1b C A 3: 141,857,522 M220I possibly damaging Het
Cacna1e T A 1: 154,471,340 N1027I probably benign Het
Cacng4 A T 11: 107,734,784 V327E probably damaging Het
Casp1 T C 9: 5,303,143 V199A probably damaging Het
Cdh13 A T 8: 118,757,474 D158V probably benign Het
Cenpe C A 3: 135,235,076 S662* probably null Het
Ctnna1 A G 18: 35,249,742 D647G probably benign Het
Dennd5a C A 7: 109,919,423 E480* probably null Het
Exoc6 T A 19: 37,578,529 V258D probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G A 1: 174,609,811 C1116Y probably damaging Het
H2-Aa T C 17: 34,283,842 T117A possibly damaging Het
Ktn1 TTGTTGTCTTTGTGTT TTGTT 14: 47,734,097 probably benign Het
Lig1 C A 7: 13,306,008 T715N probably damaging Het
Lrrc31 C A 3: 30,689,845 probably null Het
Mcm6 T C 1: 128,355,589 T60A probably damaging Het
Mex3c T A 18: 73,589,943 M369K possibly damaging Het
Mmp14 T C 14: 54,439,412 Y428H probably damaging Het
Msh6 A G 17: 87,986,901 D1028G probably damaging Het
Myo9a T C 9: 59,863,944 V933A probably damaging Het
Nepn A T 10: 52,401,137 D323V probably benign Het
Nrf1 C T 6: 30,126,246 A150V probably damaging Het
Nxpe5 A G 5: 138,239,771 T199A probably benign Het
Obscn T G 11: 59,122,848 K1150Q probably benign Het
Olfr1354 A G 10: 78,917,099 I86M possibly damaging Het
Olfr536 A C 7: 140,504,405 V18G probably benign Het
Olfr591 T C 7: 103,172,849 T263A probably damaging Het
Olfr862 T A 9: 19,883,976 M110L probably benign Het
Otop1 G A 5: 38,294,504 G184S possibly damaging Het
Pkp2 G T 16: 16,260,375 D494Y probably damaging Het
Pop5 G A 5: 115,240,201 R68Q probably damaging Het
Ppp1r13b T C 12: 111,833,789 D518G probably benign Het
Preb G T 5: 30,959,963 probably benign Het
Qrfpr A G 3: 36,180,965 V292A possibly damaging Het
Rag1 G A 2: 101,643,792 T335I probably damaging Het
Rbbp6 T A 7: 122,997,086 V617E probably damaging Het
Sf3a3 A T 4: 124,714,953 D20V probably damaging Het
Slco1b2 A G 6: 141,685,586 N649D probably benign Het
Smarcal1 A G 1: 72,586,213 D173G probably benign Het
Smg7 A G 1: 152,843,234 L914P probably damaging Het
Tbc1d32 A T 10: 56,129,150 S796T possibly damaging Het
Tex14 A G 11: 87,522,578 T1052A probably benign Het
Tspan1 A G 4: 116,164,080 V109A possibly damaging Het
Ttbk2 A G 2: 120,806,824 V51A possibly damaging Het
Tubgcp6 A G 15: 89,111,150 V419A probably benign Het
Ubr2 G T 17: 46,934,200 C1633* probably null Het
Uggt2 C T 14: 119,089,199 G200D possibly damaging Het
Vmn2r25 T C 6: 123,828,359 E513G possibly damaging Het
Zscan22 G A 7: 12,906,992 G388S probably damaging Het
Other mutations in Olfr617
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Olfr617 APN 7 103584693 missense probably damaging 1.00
IGL01355:Olfr617 APN 7 103584373 missense probably damaging 1.00
IGL01411:Olfr617 APN 7 103584117 missense probably damaging 1.00
IGL01412:Olfr617 APN 7 103584907 missense probably damaging 1.00
IGL02379:Olfr617 APN 7 103584892 missense possibly damaging 0.84
ANU23:Olfr617 UTSW 7 103584693 missense probably damaging 1.00
IGL03054:Olfr617 UTSW 7 103584840 missense probably benign 0.23
R0536:Olfr617 UTSW 7 103584261 missense probably damaging 1.00
R4222:Olfr617 UTSW 7 103584759 missense probably damaging 1.00
R4224:Olfr617 UTSW 7 103584759 missense probably damaging 1.00
R5342:Olfr617 UTSW 7 103584828 missense probably benign 0.05
R5587:Olfr617 UTSW 7 103584531 missense probably benign 0.07
R5608:Olfr617 UTSW 7 103584299 nonsense probably null
R6904:Olfr617 UTSW 7 103584520 missense possibly damaging 0.83
R6929:Olfr617 UTSW 7 103584444 missense probably damaging 0.98
R7399:Olfr617 UTSW 7 103584381 missense possibly damaging 0.78
R7607:Olfr617 UTSW 7 103584930 missense probably damaging 0.97
R7771:Olfr617 UTSW 7 103584090 missense probably benign 0.33
Z1177:Olfr617 UTSW 7 103584699 missense probably benign 0.41
Z1177:Olfr617 UTSW 7 103584947 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGATCCCAGGACTAGAATATGC -3'
(R):5'- CAGCTGCAATGCCCATTTTG -3'

Sequencing Primer
(F):5'- GAATATGCACACATATGGATCTCC -3'
(R):5'- CTGCAATGCCCATTTTGATGATGAC -3'
Posted On 2016-10-26