Incidental Mutation 'R5607:Olfr1354'
ID439352
Institutional Source Beutler Lab
Gene Symbol Olfr1354
Ensembl Gene ENSMUSG00000094673
Gene Nameolfactory receptor 1354
SynonymsGA_x6K02T2QGN0-2895081-2894349, EG257869, MOR139-5, MOR185-8, MOR139-7, GA_x6K02T03FR9-4826-3919, Olfr233-ps1
MMRRC Submission 043271-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R5607 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78913171-78920399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78917099 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 86 (I86M)
Ref Sequence ENSEMBL: ENSMUSP00000150374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075859] [ENSMUST00000204587] [ENSMUST00000217073]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075859
AA Change: I86M

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093126
Gene: ENSMUSG00000094673
AA Change: I86M

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.4e-49 PFAM
Pfam:7tm_1 42 291 3.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203132
AA Change: I86M
SMART Domains Protein: ENSMUSP00000144897
Gene: ENSMUSG00000094673
AA Change: I86M

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.4e-49 PFAM
Pfam:7tm_1 42 291 3.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204587
AA Change: I86M

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205040
AA Change: I86M
SMART Domains Protein: ENSMUSP00000144994
Gene: ENSMUSG00000094673
AA Change: I86M

DomainStartEndE-ValueType
Pfam:7tm_4 32 146 9.6e-24 PFAM
Pfam:7TM_GPCR_Srsx 36 147 1.8e-6 PFAM
Pfam:7tm_1 42 147 4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217073
AA Change: I86M

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,937,257 G1118W probably damaging Het
Ajap1 T A 4: 153,432,204 T227S possibly damaging Het
Ankmy1 A G 1: 92,877,018 F851S probably damaging Het
Blvrb C T 7: 27,459,469 P98L probably benign Het
Bmpr1b C A 3: 141,857,522 M220I possibly damaging Het
Cacna1e T A 1: 154,471,340 N1027I probably benign Het
Cacng4 A T 11: 107,734,784 V327E probably damaging Het
Casp1 T C 9: 5,303,143 V199A probably damaging Het
Cdh13 A T 8: 118,757,474 D158V probably benign Het
Cenpe C A 3: 135,235,076 S662* probably null Het
Ctnna1 A G 18: 35,249,742 D647G probably benign Het
Dennd5a C A 7: 109,919,423 E480* probably null Het
Exoc6 T A 19: 37,578,529 V258D probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G A 1: 174,609,811 C1116Y probably damaging Het
H2-Aa T C 17: 34,283,842 T117A possibly damaging Het
Ktn1 TTGTTGTCTTTGTGTT TTGTT 14: 47,734,097 probably benign Het
Lig1 C A 7: 13,306,008 T715N probably damaging Het
Lrrc31 C A 3: 30,689,845 probably null Het
Mcm6 T C 1: 128,355,589 T60A probably damaging Het
Mex3c T A 18: 73,589,943 M369K possibly damaging Het
Mmp14 T C 14: 54,439,412 Y428H probably damaging Het
Msh6 A G 17: 87,986,901 D1028G probably damaging Het
Myo9a T C 9: 59,863,944 V933A probably damaging Het
Nepn A T 10: 52,401,137 D323V probably benign Het
Nrf1 C T 6: 30,126,246 A150V probably damaging Het
Nxpe5 A G 5: 138,239,771 T199A probably benign Het
Obscn T G 11: 59,122,848 K1150Q probably benign Het
Olfr536 A C 7: 140,504,405 V18G probably benign Het
Olfr591 T C 7: 103,172,849 T263A probably damaging Het
Olfr617 G A 7: 103,584,299 W92* probably null Het
Olfr862 T A 9: 19,883,976 M110L probably benign Het
Otop1 G A 5: 38,294,504 G184S possibly damaging Het
Pkp2 G T 16: 16,260,375 D494Y probably damaging Het
Pop5 G A 5: 115,240,201 R68Q probably damaging Het
Ppp1r13b T C 12: 111,833,789 D518G probably benign Het
Preb G T 5: 30,959,963 probably benign Het
Qrfpr A G 3: 36,180,965 V292A possibly damaging Het
Rag1 G A 2: 101,643,792 T335I probably damaging Het
Rbbp6 T A 7: 122,997,086 V617E probably damaging Het
Sf3a3 A T 4: 124,714,953 D20V probably damaging Het
Slco1b2 A G 6: 141,685,586 N649D probably benign Het
Smarcal1 A G 1: 72,586,213 D173G probably benign Het
Smg7 A G 1: 152,843,234 L914P probably damaging Het
Tbc1d32 A T 10: 56,129,150 S796T possibly damaging Het
Tex14 A G 11: 87,522,578 T1052A probably benign Het
Tspan1 A G 4: 116,164,080 V109A possibly damaging Het
Ttbk2 A G 2: 120,806,824 V51A possibly damaging Het
Tubgcp6 A G 15: 89,111,150 V419A probably benign Het
Ubr2 G T 17: 46,934,200 C1633* probably null Het
Uggt2 C T 14: 119,089,199 G200D possibly damaging Het
Vmn2r25 T C 6: 123,828,359 E513G possibly damaging Het
Zscan22 G A 7: 12,906,992 G388S probably damaging Het
Other mutations in Olfr1354
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02903:Olfr1354 APN 10 78917416 missense probably damaging 0.99
IGL02962:Olfr1354 APN 10 78916939 missense probably damaging 1.00
IGL03032:Olfr1354 APN 10 78917637 missense probably benign 0.21
PIT4495001:Olfr1354 UTSW 10 78916987 missense probably benign
R0268:Olfr1354 UTSW 10 78917605 missense probably damaging 0.99
R0359:Olfr1354 UTSW 10 78917343 missense probably benign 0.00
R0382:Olfr1354 UTSW 10 78917126 nonsense probably null
R1895:Olfr1354 UTSW 10 78916924 missense probably damaging 1.00
R1946:Olfr1354 UTSW 10 78916924 missense probably damaging 1.00
R2035:Olfr1354 UTSW 10 78917587 missense possibly damaging 0.86
R3853:Olfr1354 UTSW 10 78916947 missense probably damaging 1.00
R4756:Olfr1354 UTSW 10 78917527 missense probably damaging 0.99
R5326:Olfr1354 UTSW 10 78917586 missense possibly damaging 0.86
R7070:Olfr1354 UTSW 10 78917268 missense probably benign
R7088:Olfr1354 UTSW 10 78917759 missense probably benign 0.00
R7212:Olfr1354 UTSW 10 78917505 missense possibly damaging 0.81
R7348:Olfr1354 UTSW 10 78917562 missense probably damaging 1.00
R7386:Olfr1354 UTSW 10 78916843 start codon destroyed probably null 0.98
R7847:Olfr1354 UTSW 10 78916896 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGATTTTCAGAAAACCCACAC -3'
(R):5'- GGATGCTAACAACCCAGGAC -3'

Sequencing Primer
(F):5'- TTTCAGAAAACCCACACCTTCAATTC -3'
(R):5'- GAACCATCAGTATACAGAGCTGTTG -3'
Posted On2016-10-26