Incidental Mutation 'R5607:Ktn1'
ID439356
Institutional Source Beutler Lab
Gene Symbol Ktn1
Ensembl Gene ENSMUSG00000021843
Gene Namekinectin 1
Synonyms
MMRRC Submission 043271-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5607 (G1)
Quality Score217
Status Validated
Chromosome14
Chromosomal Location47648448-47739894 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) TTGTTGTCTTTGTGTT to TTGTT at 47734097 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022391] [ENSMUST00000185343] [ENSMUST00000185940] [ENSMUST00000186627] [ENSMUST00000186761] [ENSMUST00000187039] [ENSMUST00000187262] [ENSMUST00000187839] [ENSMUST00000188330] [ENSMUST00000188553] [ENSMUST00000189101] [ENSMUST00000189533] [ENSMUST00000191018] [ENSMUST00000190182] [ENSMUST00000190535] [ENSMUST00000190999] [ENSMUST00000191511] [ENSMUST00000189986] [ENSMUST00000190252] [ENSMUST00000191446]
Predicted Effect probably benign
Transcript: ENSMUST00000022391
SMART Domains Protein: ENSMUSP00000022391
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1267 N/A INTRINSIC
coiled coil region 1302 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185343
SMART Domains Protein: ENSMUSP00000140186
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185940
SMART Domains Protein: ENSMUSP00000139625
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
coiled coil region 1198 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186627
SMART Domains Protein: ENSMUSP00000140873
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186761
SMART Domains Protein: ENSMUSP00000139521
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187039
SMART Domains Protein: ENSMUSP00000140202
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
coiled coil region 1198 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187262
SMART Domains Protein: ENSMUSP00000140206
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187839
SMART Domains Protein: ENSMUSP00000140324
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1267 N/A INTRINSIC
coiled coil region 1302 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188330
SMART Domains Protein: ENSMUSP00000140845
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188553
SMART Domains Protein: ENSMUSP00000140865
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189101
SMART Domains Protein: ENSMUSP00000140178
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189533
SMART Domains Protein: ENSMUSP00000140142
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1187 N/A INTRINSIC
coiled coil region 1222 1246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192676
Predicted Effect probably benign
Transcript: ENSMUST00000191018
SMART Domains Protein: ENSMUSP00000139585
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1220 N/A INTRINSIC
coiled coil region 1255 1279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190182
SMART Domains Protein: ENSMUSP00000140301
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1238 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190535
SMART Domains Protein: ENSMUSP00000139952
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1244 N/A INTRINSIC
coiled coil region 1279 1303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190999
SMART Domains Protein: ENSMUSP00000139673
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1215 N/A INTRINSIC
coiled coil region 1250 1274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191511
SMART Domains Protein: ENSMUSP00000139946
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1192 N/A INTRINSIC
coiled coil region 1227 1251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189986
SMART Domains Protein: ENSMUSP00000139970
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
Pfam:Rib_recp_KP_reg 29 172 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190252
SMART Domains Protein: ENSMUSP00000140011
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1210 N/A INTRINSIC
coiled coil region 1245 1269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191446
SMART Domains Protein: ENSMUSP00000140748
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1215 N/A INTRINSIC
coiled coil region 1250 1274 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 96% (54/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation or a floxed allele exhibit no discernable phenotype; mice are viable and fertile up to one year of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,937,257 G1118W probably damaging Het
Ajap1 T A 4: 153,432,204 T227S possibly damaging Het
Ankmy1 A G 1: 92,877,018 F851S probably damaging Het
Blvrb C T 7: 27,459,469 P98L probably benign Het
Bmpr1b C A 3: 141,857,522 M220I possibly damaging Het
Cacna1e T A 1: 154,471,340 N1027I probably benign Het
Cacng4 A T 11: 107,734,784 V327E probably damaging Het
Casp1 T C 9: 5,303,143 V199A probably damaging Het
Cdh13 A T 8: 118,757,474 D158V probably benign Het
Cenpe C A 3: 135,235,076 S662* probably null Het
Ctnna1 A G 18: 35,249,742 D647G probably benign Het
Dennd5a C A 7: 109,919,423 E480* probably null Het
Exoc6 T A 19: 37,578,529 V258D probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G A 1: 174,609,811 C1116Y probably damaging Het
H2-Aa T C 17: 34,283,842 T117A possibly damaging Het
Lig1 C A 7: 13,306,008 T715N probably damaging Het
Lrrc31 C A 3: 30,689,845 probably null Het
Mcm6 T C 1: 128,355,589 T60A probably damaging Het
Mex3c T A 18: 73,589,943 M369K possibly damaging Het
Mmp14 T C 14: 54,439,412 Y428H probably damaging Het
Msh6 A G 17: 87,986,901 D1028G probably damaging Het
Myo9a T C 9: 59,863,944 V933A probably damaging Het
Nepn A T 10: 52,401,137 D323V probably benign Het
Nrf1 C T 6: 30,126,246 A150V probably damaging Het
Nxpe5 A G 5: 138,239,771 T199A probably benign Het
Obscn T G 11: 59,122,848 K1150Q probably benign Het
Olfr1354 A G 10: 78,917,099 I86M possibly damaging Het
Olfr536 A C 7: 140,504,405 V18G probably benign Het
Olfr591 T C 7: 103,172,849 T263A probably damaging Het
Olfr617 G A 7: 103,584,299 W92* probably null Het
Olfr862 T A 9: 19,883,976 M110L probably benign Het
Otop1 G A 5: 38,294,504 G184S possibly damaging Het
Pkp2 G T 16: 16,260,375 D494Y probably damaging Het
Pop5 G A 5: 115,240,201 R68Q probably damaging Het
Ppp1r13b T C 12: 111,833,789 D518G probably benign Het
Preb G T 5: 30,959,963 probably benign Het
Qrfpr A G 3: 36,180,965 V292A possibly damaging Het
Rag1 G A 2: 101,643,792 T335I probably damaging Het
Rbbp6 T A 7: 122,997,086 V617E probably damaging Het
Sf3a3 A T 4: 124,714,953 D20V probably damaging Het
Slco1b2 A G 6: 141,685,586 N649D probably benign Het
Smarcal1 A G 1: 72,586,213 D173G probably benign Het
Smg7 A G 1: 152,843,234 L914P probably damaging Het
Tbc1d32 A T 10: 56,129,150 S796T possibly damaging Het
Tex14 A G 11: 87,522,578 T1052A probably benign Het
Tspan1 A G 4: 116,164,080 V109A possibly damaging Het
Ttbk2 A G 2: 120,806,824 V51A possibly damaging Het
Tubgcp6 A G 15: 89,111,150 V419A probably benign Het
Ubr2 G T 17: 46,934,200 C1633* probably null Het
Uggt2 C T 14: 119,089,199 G200D possibly damaging Het
Vmn2r25 T C 6: 123,828,359 E513G possibly damaging Het
Zscan22 G A 7: 12,906,992 G388S probably damaging Het
Other mutations in Ktn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ktn1 APN 14 47708878 missense probably benign 0.30
IGL01109:Ktn1 APN 14 47714721 missense probably damaging 1.00
IGL02300:Ktn1 APN 14 47690060 missense probably damaging 1.00
IGL02339:Ktn1 APN 14 47683378 splice site probably benign
IGL02525:Ktn1 APN 14 47724743 critical splice donor site probably null
IGL02565:Ktn1 APN 14 47672934 splice site probably benign
IGL02678:Ktn1 APN 14 47734153 critical splice acceptor site probably null
IGL03181:Ktn1 APN 14 47733284 missense probably benign 0.19
IGL03393:Ktn1 APN 14 47690934 missense probably damaging 1.00
PIT4520001:Ktn1 UTSW 14 47686317 missense probably damaging 0.96
R0035:Ktn1 UTSW 14 47730379 missense probably benign 0.07
R0035:Ktn1 UTSW 14 47730379 missense probably benign 0.07
R0270:Ktn1 UTSW 14 47714662 missense probably benign 0.00
R0370:Ktn1 UTSW 14 47664075 missense probably benign 0.00
R0371:Ktn1 UTSW 14 47724003 nonsense probably null
R0530:Ktn1 UTSW 14 47733243 missense probably benign 0.14
R0531:Ktn1 UTSW 14 47663941 missense probably damaging 0.98
R0611:Ktn1 UTSW 14 47694616 missense probably benign
R0836:Ktn1 UTSW 14 47701062 splice site probably null
R1076:Ktn1 UTSW 14 47694638 missense probably damaging 0.99
R1522:Ktn1 UTSW 14 47667416 missense probably damaging 1.00
R1554:Ktn1 UTSW 14 47695507 missense probably damaging 1.00
R1992:Ktn1 UTSW 14 47695521 missense probably damaging 1.00
R2040:Ktn1 UTSW 14 47700612 splice site probably benign
R2080:Ktn1 UTSW 14 47725960 missense probably damaging 1.00
R2110:Ktn1 UTSW 14 47693888 missense possibly damaging 0.47
R2144:Ktn1 UTSW 14 47714652 missense probably damaging 1.00
R3730:Ktn1 UTSW 14 47701149 missense probably damaging 1.00
R3780:Ktn1 UTSW 14 47706403 splice site probably benign
R3782:Ktn1 UTSW 14 47706403 splice site probably benign
R4414:Ktn1 UTSW 14 47724930 nonsense probably null
R4610:Ktn1 UTSW 14 47726179 intron probably benign
R4784:Ktn1 UTSW 14 47693496 critical splice donor site probably null
R4838:Ktn1 UTSW 14 47725956 nonsense probably null
R4909:Ktn1 UTSW 14 47706460 missense probably damaging 0.99
R4976:Ktn1 UTSW 14 47670299 critical splice donor site probably null
R5110:Ktn1 UTSW 14 47704287 splice site probably benign
R5257:Ktn1 UTSW 14 47667363 missense probably benign 0.05
R5469:Ktn1 UTSW 14 47690920 missense probably damaging 1.00
R5600:Ktn1 UTSW 14 47690033 missense probably damaging 1.00
R5608:Ktn1 UTSW 14 47734097 intron probably benign
R5920:Ktn1 UTSW 14 47724024 nonsense probably null
R6045:Ktn1 UTSW 14 47676796 missense probably damaging 1.00
R6139:Ktn1 UTSW 14 47726215 splice site probably null
R6282:Ktn1 UTSW 14 47663971 missense probably damaging 1.00
R6654:Ktn1 UTSW 14 47690000 missense probably damaging 1.00
R6957:Ktn1 UTSW 14 47667353 nonsense probably null
R6959:Ktn1 UTSW 14 47720256 missense probably damaging 1.00
R7170:Ktn1 UTSW 14 47706410 missense probably damaging 1.00
R7206:Ktn1 UTSW 14 47695528 missense probably damaging 0.97
R7442:Ktn1 UTSW 14 47714640 missense probably benign 0.01
R7462:Ktn1 UTSW 14 47694632 missense probably null 1.00
R7513:Ktn1 UTSW 14 47664084 missense possibly damaging 0.77
R7743:Ktn1 UTSW 14 47670293 missense probably damaging 1.00
R8010:Ktn1 UTSW 14 47705773 missense possibly damaging 0.60
R8062:Ktn1 UTSW 14 47724972 critical splice donor site probably null
R8244:Ktn1 UTSW 14 47674823 missense probably null 1.00
Z1177:Ktn1 UTSW 14 47692438 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAGCAGCCATGTGTTGCTCC -3'
(R):5'- ACACCTGGATTATGTCTCCTTTGTG -3'

Sequencing Primer
(F):5'- TGCCCTTTGCTGGACAGG -3'
(R):5'- GAGTTGTTGATTTACTTCCTGAAGC -3'
Posted On2016-10-26