Incidental Mutation 'R5607:Tubgcp6'
ID439359
Institutional Source Beutler Lab
Gene Symbol Tubgcp6
Ensembl Gene ENSMUSG00000051786
Gene Nametubulin, gamma complex associated protein 6
Synonyms
MMRRC Submission 043271-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5607 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89098357-89123112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89111150 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 419 (V419A)
Ref Sequence ENSEMBL: ENSMUSP00000104977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000109353]
Predicted Effect probably benign
Transcript: ENSMUST00000041656
AA Change: V419A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786
AA Change: V419A

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109353
AA Change: V419A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786
AA Change: V419A

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169069
SMART Domains Protein: ENSMUSP00000132786
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
coiled coil region 77 107 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,937,257 G1118W probably damaging Het
Ajap1 T A 4: 153,432,204 T227S possibly damaging Het
Ankmy1 A G 1: 92,877,018 F851S probably damaging Het
Blvrb C T 7: 27,459,469 P98L probably benign Het
Bmpr1b C A 3: 141,857,522 M220I possibly damaging Het
Cacna1e T A 1: 154,471,340 N1027I probably benign Het
Cacng4 A T 11: 107,734,784 V327E probably damaging Het
Casp1 T C 9: 5,303,143 V199A probably damaging Het
Cdh13 A T 8: 118,757,474 D158V probably benign Het
Cenpe C A 3: 135,235,076 S662* probably null Het
Ctnna1 A G 18: 35,249,742 D647G probably benign Het
Dennd5a C A 7: 109,919,423 E480* probably null Het
Exoc6 T A 19: 37,578,529 V258D probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G A 1: 174,609,811 C1116Y probably damaging Het
H2-Aa T C 17: 34,283,842 T117A possibly damaging Het
Ktn1 TTGTTGTCTTTGTGTT TTGTT 14: 47,734,097 probably benign Het
Lig1 C A 7: 13,306,008 T715N probably damaging Het
Lrrc31 C A 3: 30,689,845 probably null Het
Mcm6 T C 1: 128,355,589 T60A probably damaging Het
Mex3c T A 18: 73,589,943 M369K possibly damaging Het
Mmp14 T C 14: 54,439,412 Y428H probably damaging Het
Msh6 A G 17: 87,986,901 D1028G probably damaging Het
Myo9a T C 9: 59,863,944 V933A probably damaging Het
Nepn A T 10: 52,401,137 D323V probably benign Het
Nrf1 C T 6: 30,126,246 A150V probably damaging Het
Nxpe5 A G 5: 138,239,771 T199A probably benign Het
Obscn T G 11: 59,122,848 K1150Q probably benign Het
Olfr1354 A G 10: 78,917,099 I86M possibly damaging Het
Olfr536 A C 7: 140,504,405 V18G probably benign Het
Olfr591 T C 7: 103,172,849 T263A probably damaging Het
Olfr617 G A 7: 103,584,299 W92* probably null Het
Olfr862 T A 9: 19,883,976 M110L probably benign Het
Otop1 G A 5: 38,294,504 G184S possibly damaging Het
Pkp2 G T 16: 16,260,375 D494Y probably damaging Het
Pop5 G A 5: 115,240,201 R68Q probably damaging Het
Ppp1r13b T C 12: 111,833,789 D518G probably benign Het
Preb G T 5: 30,959,963 probably benign Het
Qrfpr A G 3: 36,180,965 V292A possibly damaging Het
Rag1 G A 2: 101,643,792 T335I probably damaging Het
Rbbp6 T A 7: 122,997,086 V617E probably damaging Het
Sf3a3 A T 4: 124,714,953 D20V probably damaging Het
Slco1b2 A G 6: 141,685,586 N649D probably benign Het
Smarcal1 A G 1: 72,586,213 D173G probably benign Het
Smg7 A G 1: 152,843,234 L914P probably damaging Het
Tbc1d32 A T 10: 56,129,150 S796T possibly damaging Het
Tex14 A G 11: 87,522,578 T1052A probably benign Het
Tspan1 A G 4: 116,164,080 V109A possibly damaging Het
Ttbk2 A G 2: 120,806,824 V51A possibly damaging Het
Ubr2 G T 17: 46,934,200 C1633* probably null Het
Uggt2 C T 14: 119,089,199 G200D possibly damaging Het
Vmn2r25 T C 6: 123,828,359 E513G possibly damaging Het
Zscan22 G A 7: 12,906,992 G388S probably damaging Het
Other mutations in Tubgcp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tubgcp6 APN 15 89104008 missense probably benign 0.00
IGL00556:Tubgcp6 APN 15 89100962 missense probably damaging 1.00
IGL00943:Tubgcp6 APN 15 89122397 nonsense probably null
IGL01284:Tubgcp6 APN 15 89110055 missense probably damaging 1.00
IGL01363:Tubgcp6 APN 15 89107525 missense probably damaging 1.00
IGL01386:Tubgcp6 APN 15 89107996 nonsense probably null
IGL01792:Tubgcp6 APN 15 89101281 missense probably damaging 1.00
IGL01866:Tubgcp6 APN 15 89103488 missense probably benign 0.01
IGL02596:Tubgcp6 APN 15 89100914 missense probably damaging 1.00
IGL02858:Tubgcp6 APN 15 89102315 nonsense probably null
IGL02873:Tubgcp6 APN 15 89103824 missense probably benign 0.00
IGL03400:Tubgcp6 APN 15 89108099 unclassified probably benign
IGL02796:Tubgcp6 UTSW 15 89122390 missense probably benign 0.03
R0010:Tubgcp6 UTSW 15 89103183 missense probably benign 0.00
R0308:Tubgcp6 UTSW 15 89122436 missense possibly damaging 0.85
R0440:Tubgcp6 UTSW 15 89103065 missense probably benign 0.12
R0631:Tubgcp6 UTSW 15 89100987 missense probably damaging 1.00
R1653:Tubgcp6 UTSW 15 89107442 missense probably damaging 1.00
R1901:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1902:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1905:Tubgcp6 UTSW 15 89100608 missense probably damaging 1.00
R2005:Tubgcp6 UTSW 15 89104166 missense probably benign 0.01
R2067:Tubgcp6 UTSW 15 89104489 missense probably benign 0.03
R2083:Tubgcp6 UTSW 15 89122376 missense probably damaging 1.00
R2285:Tubgcp6 UTSW 15 89122474 missense probably damaging 1.00
R2401:Tubgcp6 UTSW 15 89102984 missense probably benign 0.22
R2436:Tubgcp6 UTSW 15 89102365 missense probably benign 0.37
R3017:Tubgcp6 UTSW 15 89103082 nonsense probably null
R3054:Tubgcp6 UTSW 15 89122603 missense probably damaging 1.00
R3932:Tubgcp6 UTSW 15 89104414 unclassified probably benign
R4350:Tubgcp6 UTSW 15 89103995 missense probably benign 0.00
R4472:Tubgcp6 UTSW 15 89103654 missense probably damaging 0.98
R4864:Tubgcp6 UTSW 15 89103818 missense probably benign
R4937:Tubgcp6 UTSW 15 89101549 missense probably damaging 0.98
R4983:Tubgcp6 UTSW 15 89106291 missense probably damaging 1.00
R4996:Tubgcp6 UTSW 15 89103490 missense possibly damaging 0.89
R5044:Tubgcp6 UTSW 15 89099545 unclassified probably benign
R5122:Tubgcp6 UTSW 15 89116103 missense probably damaging 1.00
R5608:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5653:Tubgcp6 UTSW 15 89108612 missense possibly damaging 0.47
R5886:Tubgcp6 UTSW 15 89103247 missense possibly damaging 0.82
R5945:Tubgcp6 UTSW 15 89109217 splice site probably null
R6111:Tubgcp6 UTSW 15 89100920 missense possibly damaging 0.83
R6195:Tubgcp6 UTSW 15 89122791 missense probably benign 0.01
R6792:Tubgcp6 UTSW 15 89122877 start gained probably benign
R7074:Tubgcp6 UTSW 15 89120636 missense probably damaging 1.00
R7103:Tubgcp6 UTSW 15 89101029 missense probably damaging 0.96
R7274:Tubgcp6 UTSW 15 89102970 nonsense probably null
R7275:Tubgcp6 UTSW 15 89102943 nonsense probably null
R7514:Tubgcp6 UTSW 15 89120525 missense probably damaging 1.00
R7540:Tubgcp6 UTSW 15 89102323 missense possibly damaging 0.48
R7571:Tubgcp6 UTSW 15 89100722 missense probably damaging 1.00
R7706:Tubgcp6 UTSW 15 89104223 missense probably benign
R7721:Tubgcp6 UTSW 15 89101401 missense probably damaging 1.00
R7996:Tubgcp6 UTSW 15 89109028 missense possibly damaging 0.92
R8095:Tubgcp6 UTSW 15 89122774 missense probably benign 0.07
R8191:Tubgcp6 UTSW 15 89120640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGCACTTGGTCCTTGCC -3'
(R):5'- TTGGTGTGTGACCTCTAACCC -3'

Sequencing Primer
(F):5'- AAATTCCCTAACTGTTCACACCTG -3'
(R):5'- GTGTGTGACCTCTAACCCCTTCC -3'
Posted On2016-10-26