Incidental Mutation 'R5607:Ctnna1'
ID439364
Institutional Source Beutler Lab
Gene Symbol Ctnna1
Ensembl Gene ENSMUSG00000037815
Gene Namecatenin (cadherin associated protein), alpha 1
Synonymsalpha E catenin, alpha(E)-catenin, 2010010M04Rik, Catna1
MMRRC Submission 043271-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5607 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location35118888-35254773 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35249742 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 647 (D647G)
Ref Sequence ENSEMBL: ENSMUSP00000049007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042345]
PDB Structure
CRYSTAL STRUCTURE OF THE ALPHA-CATENIN DIMERIZATION DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF A CHIMERA OF BETA-CATENIN AND ALPHA-CATENIN [X-RAY DIFFRACTION]
alpha-catenin fragment, residues 385-651 [X-RAY DIFFRACTION]
Alpha-E-catenin is an autoinhibited molecule that co-activates vinculin [X-RAY DIFFRACTION]
Alpha-E-catenin is an autoinhibited molecule that co-activates vinculin [X-RAY DIFFRACTION]
Crystal structure of full-length mouse alphaE-catenin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000042345
AA Change: D647G

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049007
Gene: ENSMUSG00000037815
AA Change: D647G

DomainStartEndE-ValueType
Pfam:Vinculin 19 339 2.6e-99 PFAM
Pfam:Vinculin 333 867 3.3e-218 PFAM
Meta Mutation Damage Score 0.0870 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the catenin family of proteins that play an important role in cell adhesion process by connecting cadherins located on the plasma membrane to the actin filaments inside the cell. The encoded mechanosensing protein contains three vinculin homology domains and undergoes conformational changes in response to cytoskeletal tension, resulting in the reconfiguration of cadherin-actin filament connections. Certain mutations in this gene cause butterfly-shaped pigment dystrophy. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at the blastocyst stage. A conditional knockout in surface epithelium results in defects in hair follicle development and epidermal morphogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,937,257 G1118W probably damaging Het
Ajap1 T A 4: 153,432,204 T227S possibly damaging Het
Ankmy1 A G 1: 92,877,018 F851S probably damaging Het
Blvrb C T 7: 27,459,469 P98L probably benign Het
Bmpr1b C A 3: 141,857,522 M220I possibly damaging Het
Cacna1e T A 1: 154,471,340 N1027I probably benign Het
Cacng4 A T 11: 107,734,784 V327E probably damaging Het
Casp1 T C 9: 5,303,143 V199A probably damaging Het
Cdh13 A T 8: 118,757,474 D158V probably benign Het
Cenpe C A 3: 135,235,076 S662* probably null Het
Dennd5a C A 7: 109,919,423 E480* probably null Het
Exoc6 T A 19: 37,578,529 V258D probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G A 1: 174,609,811 C1116Y probably damaging Het
H2-Aa T C 17: 34,283,842 T117A possibly damaging Het
Ktn1 TTGTTGTCTTTGTGTT TTGTT 14: 47,734,097 probably benign Het
Lig1 C A 7: 13,306,008 T715N probably damaging Het
Lrrc31 C A 3: 30,689,845 probably null Het
Mcm6 T C 1: 128,355,589 T60A probably damaging Het
Mex3c T A 18: 73,589,943 M369K possibly damaging Het
Mmp14 T C 14: 54,439,412 Y428H probably damaging Het
Msh6 A G 17: 87,986,901 D1028G probably damaging Het
Myo9a T C 9: 59,863,944 V933A probably damaging Het
Nepn A T 10: 52,401,137 D323V probably benign Het
Nrf1 C T 6: 30,126,246 A150V probably damaging Het
Nxpe5 A G 5: 138,239,771 T199A probably benign Het
Obscn T G 11: 59,122,848 K1150Q probably benign Het
Olfr1354 A G 10: 78,917,099 I86M possibly damaging Het
Olfr536 A C 7: 140,504,405 V18G probably benign Het
Olfr591 T C 7: 103,172,849 T263A probably damaging Het
Olfr617 G A 7: 103,584,299 W92* probably null Het
Olfr862 T A 9: 19,883,976 M110L probably benign Het
Otop1 G A 5: 38,294,504 G184S possibly damaging Het
Pkp2 G T 16: 16,260,375 D494Y probably damaging Het
Pop5 G A 5: 115,240,201 R68Q probably damaging Het
Ppp1r13b T C 12: 111,833,789 D518G probably benign Het
Preb G T 5: 30,959,963 probably benign Het
Qrfpr A G 3: 36,180,965 V292A possibly damaging Het
Rag1 G A 2: 101,643,792 T335I probably damaging Het
Rbbp6 T A 7: 122,997,086 V617E probably damaging Het
Sf3a3 A T 4: 124,714,953 D20V probably damaging Het
Slco1b2 A G 6: 141,685,586 N649D probably benign Het
Smarcal1 A G 1: 72,586,213 D173G probably benign Het
Smg7 A G 1: 152,843,234 L914P probably damaging Het
Tbc1d32 A T 10: 56,129,150 S796T possibly damaging Het
Tex14 A G 11: 87,522,578 T1052A probably benign Het
Tspan1 A G 4: 116,164,080 V109A possibly damaging Het
Ttbk2 A G 2: 120,806,824 V51A possibly damaging Het
Tubgcp6 A G 15: 89,111,150 V419A probably benign Het
Ubr2 G T 17: 46,934,200 C1633* probably null Het
Uggt2 C T 14: 119,089,199 G200D possibly damaging Het
Vmn2r25 T C 6: 123,828,359 E513G possibly damaging Het
Zscan22 G A 7: 12,906,992 G388S probably damaging Het
Other mutations in Ctnna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Ctnna1 APN 18 35223448 missense probably damaging 0.97
IGL03068:Ctnna1 APN 18 35249732 missense possibly damaging 0.66
IGL03286:Ctnna1 APN 18 35175153 missense probably benign 0.37
PIT4458001:Ctnna1 UTSW 18 35175126 missense possibly damaging 0.65
R0282:Ctnna1 UTSW 18 35244122 missense possibly damaging 0.79
R1971:Ctnna1 UTSW 18 35154527 missense probably benign
R2117:Ctnna1 UTSW 18 35152625 missense possibly damaging 0.76
R2424:Ctnna1 UTSW 18 35253707 missense probably benign 0.00
R4602:Ctnna1 UTSW 18 35179827 missense possibly damaging 0.92
R4812:Ctnna1 UTSW 18 35239477 missense probably damaging 1.00
R5120:Ctnna1 UTSW 18 35182554 critical splice donor site probably null
R5469:Ctnna1 UTSW 18 35239520 missense probably benign 0.00
R5629:Ctnna1 UTSW 18 35249749 missense probably benign
R5824:Ctnna1 UTSW 18 35179886 missense probably benign
R5971:Ctnna1 UTSW 18 35154514 missense probably benign
R6191:Ctnna1 UTSW 18 35174355 missense probably damaging 1.00
R7065:Ctnna1 UTSW 18 35152616 missense probably benign
R7519:Ctnna1 UTSW 18 35174371 missense probably benign 0.02
R7624:Ctnna1 UTSW 18 35244844 missense probably benign 0.00
R7636:Ctnna1 UTSW 18 35223473 missense possibly damaging 0.92
R8086:Ctnna1 UTSW 18 35152660 missense possibly damaging 0.55
U15987:Ctnna1 UTSW 18 35154514 missense probably benign
X0021:Ctnna1 UTSW 18 35182545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAGCTTTCTTTACAGAGAGGGTG -3'
(R):5'- ACTAGCAGCTGCCATGACTG -3'

Sequencing Primer
(F):5'- TGAGGAGGCTGACACACTGC -3'
(R):5'- GACTGAGGATTTTAGCTGTACTCCAC -3'
Posted On2016-10-26