Incidental Mutation 'R5608:Bmpr1b'
ID439379
Institutional Source Beutler Lab
Gene Symbol Bmpr1b
Ensembl Gene ENSMUSG00000052430
Gene Namebone morphogenetic protein receptor, type 1B
SynonymsBMPR-IB, Alk6, Acvrlk6, CFK-43a
MMRRC Submission 043272-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.752) question?
Stock #R5608 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location141837136-142169425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 141857522 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 220 (M220I)
Ref Sequence ENSEMBL: ENSMUSP00000101839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029948] [ENSMUST00000098568] [ENSMUST00000106230] [ENSMUST00000106232] [ENSMUST00000131273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029948
AA Change: M220I

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029948
Gene: ENSMUSG00000052430
AA Change: M220I

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000098568
AA Change: M220I

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096167
Gene: ENSMUSG00000052430
AA Change: M220I

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000106230
AA Change: M220I

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101837
Gene: ENSMUSG00000052430
AA Change: M220I

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000106232
AA Change: M220I

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101839
Gene: ENSMUSG00000052430
AA Change: M220I

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131273
SMART Domains Protein: ENSMUSP00000117478
Gene: ENSMUSG00000052430

DomainStartEndE-ValueType
PDB:3EVS|C 13 47 1e-18 PDB
SCOP:d1es7b_ 28 47 2e-4 SMART
Meta Mutation Damage Score 0.1051 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: This gene encodes a serine/threonine kinase that functions as a receptor for bone morphogenetic proteins (BMPs). The encoded protein is a type I receptor, and forms a complex of two type II and two type I receptors at the cell membrane. This complex signals downstream to activate SMAD transcriptional regulators. This signaling is important in skeletal and bone development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mutantions of this gene affect the shape of the distal limb skeleton resulting in brachydactyly or failure to generate digit cartilage. Furthermore, inactivation results in female sterility due to abnormal oestrus cyclicity as well as retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,048 Q1017R probably damaging Het
Adamtsl5 T C 10: 80,342,947 D199G probably benign Het
Adgrl1 G T 8: 83,937,257 G1118W probably damaging Het
Adgrv1 T C 13: 81,155,276 E117G probably damaging Het
Alkbh7 A T 17: 56,998,446 I88F probably damaging Het
Ankrd26 C A 6: 118,511,622 D1359Y probably damaging Het
Apoo-ps T C 13: 107,414,209 noncoding transcript Het
Arfgap2 G A 2: 91,270,202 R298H probably damaging Het
Birc6 G A 17: 74,613,544 V2109I probably damaging Het
Blvrb C T 7: 27,459,469 P98L probably benign Het
Bpifa1 T C 2: 154,147,575 probably benign Het
Capn7 A G 14: 31,370,707 Y737C probably damaging Het
Cdh13 A T 8: 118,757,474 D158V probably benign Het
Cenpe C A 3: 135,235,076 S662* probably null Het
Colec12 T A 18: 9,848,267 D148E possibly damaging Het
Dennd5a C A 7: 109,919,423 E480* probably null Het
Dpysl4 T C 7: 139,098,543 V473A probably damaging Het
Dyrk3 T C 1: 131,128,715 S574G probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
H2-Aa T C 17: 34,283,842 T117A possibly damaging Het
Helq C T 5: 100,790,219 G454S probably damaging Het
Incenp CGCTGCTGCTGC CGCTGCTGCTGCTGC 19: 9,893,868 probably benign Het
Ktn1 TTGTTGTCTTTGTGTT TTGTT 14: 47,734,097 probably benign Het
Lig1 C A 7: 13,306,008 T715N probably damaging Het
Lrrc31 C A 3: 30,689,845 probably null Het
Ltbp2 A C 12: 84,787,464 probably null Het
Marcks A T 10: 37,136,916 V41E probably damaging Het
Mex3c T A 18: 73,589,943 M369K possibly damaging Het
Msh6 A G 17: 87,986,901 D1028G probably damaging Het
Nhlrc3 C T 3: 53,462,311 probably null Het
Olfr145 G A 9: 37,897,782 C126Y probably damaging Het
Olfr353 A G 2: 36,890,515 F111S probably damaging Het
Olfr591 T C 7: 103,172,849 T263A probably damaging Het
Olfr617 G A 7: 103,584,299 W92* probably null Het
Pcdhga6 A G 18: 37,707,461 N78S possibly damaging Het
Plag1 T A 4: 3,905,463 K76* probably null Het
Ptpn21 T A 12: 98,688,777 T644S probably benign Het
Qrfpr A G 3: 36,180,965 V292A possibly damaging Het
Rbbp6 T A 7: 122,997,086 V617E probably damaging Het
Rnf157 A T 11: 116,396,320 probably null Het
Serpina5 A C 12: 104,103,744 Y300S probably damaging Het
Slc41a3 A G 6: 90,640,907 K279R probably benign Het
Smndc1 A G 19: 53,383,653 V110A probably benign Het
Tubgcp6 A G 15: 89,111,150 V419A probably benign Het
Uggt2 C T 14: 119,089,199 G200D possibly damaging Het
Utrn A T 10: 12,671,837 S1620T probably benign Het
Xkr4 T C 1: 3,671,380 probably benign Het
Zscan22 G A 7: 12,906,992 G388S probably damaging Het
Other mutations in Bmpr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Bmpr1b APN 3 141871338 missense probably damaging 1.00
IGL01394:Bmpr1b APN 3 141862981 critical splice donor site probably null
IGL02078:Bmpr1b APN 3 141870737 missense possibly damaging 0.63
IGL02315:Bmpr1b APN 3 141857529 missense probably damaging 1.00
IGL02600:Bmpr1b APN 3 141840727 missense probably damaging 1.00
IGL02709:Bmpr1b APN 3 141856553 missense probably damaging 1.00
IGL02972:Bmpr1b APN 3 141870758 missense probably benign 0.00
IGL03305:Bmpr1b APN 3 141843024 splice site probably benign
PIT4366001:Bmpr1b UTSW 3 141880463 missense probably benign
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0463:Bmpr1b UTSW 3 141857430 missense possibly damaging 0.53
R0880:Bmpr1b UTSW 3 141870796 nonsense probably null
R1449:Bmpr1b UTSW 3 141871373 missense possibly damaging 0.79
R1815:Bmpr1b UTSW 3 141880363 missense probably benign 0.03
R1852:Bmpr1b UTSW 3 141857402 critical splice donor site probably null
R1971:Bmpr1b UTSW 3 141857572 missense probably damaging 1.00
R2064:Bmpr1b UTSW 3 141870807 missense probably benign 0.00
R2299:Bmpr1b UTSW 3 141845202 missense probably damaging 1.00
R2912:Bmpr1b UTSW 3 141880378 missense probably benign 0.00
R4899:Bmpr1b UTSW 3 141840683 missense probably damaging 1.00
R4960:Bmpr1b UTSW 3 141870785 missense probably damaging 1.00
R4970:Bmpr1b UTSW 3 141845187 missense probably damaging 1.00
R5331:Bmpr1b UTSW 3 141856415 missense probably damaging 1.00
R5607:Bmpr1b UTSW 3 141857522 missense possibly damaging 0.70
R5829:Bmpr1b UTSW 3 141845157 missense probably benign 0.00
R5855:Bmpr1b UTSW 3 141871385 missense possibly damaging 0.76
R5933:Bmpr1b UTSW 3 141871367 makesense probably null
R6310:Bmpr1b UTSW 3 141864536 missense probably damaging 0.97
R6469:Bmpr1b UTSW 3 141856461 missense possibly damaging 0.95
R6826:Bmpr1b UTSW 3 141857406 missense probably damaging 1.00
R7167:Bmpr1b UTSW 3 141863080 missense probably benign 0.03
R7526:Bmpr1b UTSW 3 141856599 missense probably damaging 1.00
R8136:Bmpr1b UTSW 3 141856382 missense probably damaging 1.00
R8518:Bmpr1b UTSW 3 141857582 missense possibly damaging 0.95
Z1176:Bmpr1b UTSW 3 141842954 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GATGAGTTCATATGCAGATGTGC -3'
(R):5'- CACGTTGGTCTATCAAGTAGGAG -3'

Sequencing Primer
(F):5'- CAGATGTGCAGAGGAAGACAG -3'
(R):5'- TTTGGGTCTTACCAGGTC -3'
Posted On2016-10-26