Incidental Mutation 'R5608:Dpysl4'
ID439392
Institutional Source Beutler Lab
Gene Symbol Dpysl4
Ensembl Gene ENSMUSG00000025478
Gene Namedihydropyrimidinase-like 4
SynonymsDrp-4, Ulip4, Crmp3, CRMP-3, unc-33-like phosphoprotein 4, DPY4
MMRRC Submission 043272-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5608 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location139086001-139102704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139098543 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 473 (V473A)
Ref Sequence ENSEMBL: ENSMUSP00000112896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026551] [ENSMUST00000121184] [ENSMUST00000145499]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026551
AA Change: V452A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026551
Gene: ENSMUSG00000025478
AA Change: V452A

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 4.5e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121184
AA Change: V473A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112896
Gene: ENSMUSG00000025478
AA Change: V473A

DomainStartEndE-ValueType
Pfam:Amidohydro_1 85 474 1.1e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139364
Predicted Effect probably benign
Transcript: ENSMUST00000145499
SMART Domains Protein: ENSMUSP00000117764
Gene: ENSMUSG00000025478

DomainStartEndE-ValueType
Pfam:Amidohydro_1 1 148 2.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154273
Meta Mutation Damage Score 0.2853 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 95% (54/57)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit abnormal neurite outgrowth and lamination in the hippocampus, altered dendrite arborization and spine morphology in hippocampal pyramidal cells, and impaired LTP induction in the CA1 region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,048 Q1017R probably damaging Het
Adamtsl5 T C 10: 80,342,947 D199G probably benign Het
Adgrl1 G T 8: 83,937,257 G1118W probably damaging Het
Adgrv1 T C 13: 81,155,276 E117G probably damaging Het
Alkbh7 A T 17: 56,998,446 I88F probably damaging Het
Ankrd26 C A 6: 118,511,622 D1359Y probably damaging Het
Apoo-ps T C 13: 107,414,209 noncoding transcript Het
Arfgap2 G A 2: 91,270,202 R298H probably damaging Het
Birc6 G A 17: 74,613,544 V2109I probably damaging Het
Blvrb C T 7: 27,459,469 P98L probably benign Het
Bmpr1b C A 3: 141,857,522 M220I possibly damaging Het
Bpifa1 T C 2: 154,147,575 probably benign Het
Capn7 A G 14: 31,370,707 Y737C probably damaging Het
Cdh13 A T 8: 118,757,474 D158V probably benign Het
Cenpe C A 3: 135,235,076 S662* probably null Het
Colec12 T A 18: 9,848,267 D148E possibly damaging Het
Dennd5a C A 7: 109,919,423 E480* probably null Het
Dyrk3 T C 1: 131,128,715 S574G probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
H2-Aa T C 17: 34,283,842 T117A possibly damaging Het
Helq C T 5: 100,790,219 G454S probably damaging Het
Incenp CGCTGCTGCTGC CGCTGCTGCTGCTGC 19: 9,893,868 probably benign Het
Ktn1 TTGTTGTCTTTGTGTT TTGTT 14: 47,734,097 probably benign Het
Lig1 C A 7: 13,306,008 T715N probably damaging Het
Lrrc31 C A 3: 30,689,845 probably null Het
Ltbp2 A C 12: 84,787,464 probably null Het
Marcks A T 10: 37,136,916 V41E probably damaging Het
Mex3c T A 18: 73,589,943 M369K possibly damaging Het
Msh6 A G 17: 87,986,901 D1028G probably damaging Het
Nhlrc3 C T 3: 53,462,311 probably null Het
Olfr145 G A 9: 37,897,782 C126Y probably damaging Het
Olfr353 A G 2: 36,890,515 F111S probably damaging Het
Olfr591 T C 7: 103,172,849 T263A probably damaging Het
Olfr617 G A 7: 103,584,299 W92* probably null Het
Pcdhga6 A G 18: 37,707,461 N78S possibly damaging Het
Plag1 T A 4: 3,905,463 K76* probably null Het
Ptpn21 T A 12: 98,688,777 T644S probably benign Het
Qrfpr A G 3: 36,180,965 V292A possibly damaging Het
Rbbp6 T A 7: 122,997,086 V617E probably damaging Het
Rnf157 A T 11: 116,396,320 probably null Het
Serpina5 A C 12: 104,103,744 Y300S probably damaging Het
Slc41a3 A G 6: 90,640,907 K279R probably benign Het
Smndc1 A G 19: 53,383,653 V110A probably benign Het
Tubgcp6 A G 15: 89,111,150 V419A probably benign Het
Uggt2 C T 14: 119,089,199 G200D possibly damaging Het
Utrn A T 10: 12,671,837 S1620T probably benign Het
Xkr4 T C 1: 3,671,380 probably benign Het
Zscan22 G A 7: 12,906,992 G388S probably damaging Het
Other mutations in Dpysl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Dpysl4 APN 7 139096176 missense probably damaging 1.00
IGL01836:Dpysl4 APN 7 139096173 missense possibly damaging 0.96
IGL02447:Dpysl4 APN 7 139098600 missense probably damaging 1.00
IGL02515:Dpysl4 APN 7 139096735 missense probably damaging 1.00
IGL03169:Dpysl4 APN 7 139099910 splice site probably null
PIT4382001:Dpysl4 UTSW 7 139089578 nonsense probably null
R0012:Dpysl4 UTSW 7 139097883 missense probably benign 0.32
R0012:Dpysl4 UTSW 7 139097883 missense probably benign 0.32
R1624:Dpysl4 UTSW 7 139089553 missense probably damaging 1.00
R1642:Dpysl4 UTSW 7 139090338 missense probably damaging 1.00
R1860:Dpysl4 UTSW 7 139090299 missense probably benign
R1885:Dpysl4 UTSW 7 139096807 missense probably damaging 1.00
R1995:Dpysl4 UTSW 7 139096770 missense probably benign
R2698:Dpysl4 UTSW 7 139096765 missense probably damaging 1.00
R3032:Dpysl4 UTSW 7 139096236 missense probably benign 0.01
R3762:Dpysl4 UTSW 7 139096756 missense probably damaging 1.00
R3851:Dpysl4 UTSW 7 139100935 missense probably damaging 1.00
R3852:Dpysl4 UTSW 7 139100935 missense probably damaging 1.00
R4609:Dpysl4 UTSW 7 139098621 missense probably damaging 0.99
R4972:Dpysl4 UTSW 7 139090290 missense probably damaging 1.00
R5538:Dpysl4 UTSW 7 139091990 missense probably benign
R5762:Dpysl4 UTSW 7 139091937 missense probably benign
R5887:Dpysl4 UTSW 7 139096276 missense possibly damaging 0.72
R6022:Dpysl4 UTSW 7 139086084 unclassified probably benign
R6060:Dpysl4 UTSW 7 139089408 start codon destroyed probably null
R6180:Dpysl4 UTSW 7 139090334 missense probably damaging 1.00
R6328:Dpysl4 UTSW 7 139099818 missense probably benign
R6809:Dpysl4 UTSW 7 139093660 missense probably benign 0.19
R6949:Dpysl4 UTSW 7 139091999 missense probably damaging 1.00
R7647:Dpysl4 UTSW 7 139099773 missense possibly damaging 0.92
R7695:Dpysl4 UTSW 7 139086123 start codon destroyed probably null 0.00
R7751:Dpysl4 UTSW 7 139089540 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGTCTGCCTTAGTTGCATG -3'
(R):5'- GTGAATGGCTTCCACTGTGC -3'

Sequencing Primer
(F):5'- CTGCCTTAGTTGCATGTGTTTC -3'
(R):5'- GTGCCTTCCAAATCCACATTAG -3'
Posted On2016-10-26