Incidental Mutation 'R0496:Mthfd1l'
ID43941
Institutional Source Beutler Lab
Gene Symbol Mthfd1l
Ensembl Gene ENSMUSG00000040675
Gene Namemethylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
SynonymsFthfsdc1, 2410004L15Rik
MMRRC Submission 038692-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0496 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location3973118-4167081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 4090006 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 806 (R806G)
Ref Sequence ENSEMBL: ENSMUSP00000112897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043735] [ENSMUST00000117291] [ENSMUST00000120585]
Predicted Effect probably benign
Transcript: ENSMUST00000043735
AA Change: R806G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036178
Gene: ENSMUSG00000040675
AA Change: R806G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 71 179 2.9e-15 PFAM
Pfam:THF_DHG_CYH_C 182 337 1.1e-27 PFAM
Pfam:FTHFS 358 977 1.2e-260 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117291
AA Change: R806G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112870
Gene: ENSMUSG00000040675
AA Change: R806G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 71 179 2.9e-15 PFAM
Pfam:THF_DHG_CYH_C 182 337 1.1e-27 PFAM
Pfam:FTHFS 358 977 1.2e-260 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120585
AA Change: R806G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112897
Gene: ENSMUSG00000040675
AA Change: R806G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 70 179 8e-17 PFAM
Pfam:THF_DHG_CYH_C 182 337 5.4e-28 PFAM
Pfam:FTHFS 359 977 7.2e-260 PFAM
Meta Mutation Damage Score 0.1111 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of tetrahydrofolate (THF) in the mitochondrion. THF is important in the de novo synthesis of purines and thymidylate and in the regeneration of methionine from homocysteine. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality, delayed embryonic growth, craniofacial anomalies, and neural tube defects including craniorachischisis, exencephaly and/or a wavy neural tube. Maternal formate supplementation reduces the incidence of NTDs and improves embryonic growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,244 K1065E probably damaging Het
4932438A13Rik A G 3: 36,987,635 T2721A probably damaging Het
4933402N03Rik T C 7: 131,146,131 N44S probably benign Het
Abca13 A G 11: 9,291,701 D1188G probably benign Het
Abcb11 C T 2: 69,277,884 probably benign Het
Abcc8 A T 7: 46,108,820 I1274N probably damaging Het
Adamtsl1 G A 4: 86,341,198 C827Y probably damaging Het
Agap3 T A 5: 24,501,243 V369E probably damaging Het
Ankrd13b G A 11: 77,473,041 R195C probably damaging Het
Ap3b1 A G 13: 94,472,938 probably benign Het
Arhgef40 A T 14: 52,004,907 probably benign Het
Atad5 A G 11: 80,100,356 I692V probably benign Het
Atp5b G T 10: 128,086,174 R310L possibly damaging Het
AY358078 A T 14: 51,803,532 M103L unknown Het
Bcl9l T G 9: 44,509,518 V1370G probably benign Het
Bglap3 T A 3: 88,369,137 Q38L probably damaging Het
Cd38 T C 5: 43,868,891 F6L probably damaging Het
Cela3a A C 4: 137,404,468 V138G probably damaging Het
Clvs1 T A 4: 9,424,241 I229N probably damaging Het
Cpne1 G A 2: 156,079,419 H16Y probably damaging Het
Ctc1 T C 11: 69,035,507 L1069P probably damaging Het
Ctgf G T 10: 24,597,515 M317I possibly damaging Het
Dgkd G A 1: 87,936,900 S996N probably null Het
Dnah9 A T 11: 66,075,135 M1685K probably null Het
Dnajb12 C T 10: 59,879,801 R42* probably null Het
Dock5 T C 14: 67,817,518 Q633R probably damaging Het
Dync2h1 A G 9: 7,155,180 M868T probably benign Het
Enpp1 G T 10: 24,672,052 H208Q probably benign Het
Epha7 T A 4: 28,821,292 D152E probably damaging Het
Fancd2 T C 6: 113,555,130 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gm10964 A T 3: 103,739,429 probably null Het
Gm7075 G T 10: 63,421,602 C46* probably null Het
Gpbar1 T C 1: 74,278,981 F128L probably benign Het
Gsx2 T A 5: 75,077,065 M226K probably benign Het
Gucd1 T C 10: 75,511,266 D50G possibly damaging Het
Has1 A G 17: 17,843,746 Y544H probably benign Het
Hc A T 2: 35,013,571 Y1024N probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ift122 T A 6: 115,905,902 H659Q probably benign Het
Itga2 T C 13: 114,853,899 Q902R probably benign Het
Itgb2l T C 16: 96,434,701 K181E possibly damaging Het
Jak3 A T 8: 71,682,397 H558L probably damaging Het
Kcnh8 A G 17: 52,725,858 T58A probably benign Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt33a C T 11: 100,012,329 probably benign Het
Magi2 A T 5: 20,661,359 probably benign Het
Map4 G A 9: 110,039,850 probably benign Het
Map4k4 T A 1: 40,006,822 S754T probably damaging Het
Mapk8ip3 A G 17: 24,914,450 probably benign Het
Mib1 A G 18: 10,804,773 S918G probably benign Het
Mipol1 T A 12: 57,457,177 V377D probably damaging Het
Mlh1 T C 9: 111,241,556 T364A probably benign Het
Mta1 C T 12: 113,131,321 Q400* probably null Het
Myh13 C A 11: 67,348,815 N730K probably damaging Het
Myom1 A G 17: 71,084,306 K937E probably damaging Het
Naxd T C 8: 11,510,224 probably benign Het
Negr1 G T 3: 157,016,267 K159N probably damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1170 A T 2: 88,224,155 Y292* probably null Het
Olfr137 A G 17: 38,304,658 S268P probably damaging Het
Olfr397 T C 11: 73,964,880 S91P probably benign Het
Olfr584 T C 7: 103,085,590 I19T probably damaging Het
Olfr620 C T 7: 103,611,997 A119T probably benign Het
Pcsk6 G A 7: 65,927,249 S58N probably benign Het
Pdzrn3 G A 6: 101,150,570 T1045I possibly damaging Het
Pitrm1 T C 13: 6,568,714 L641P probably damaging Het
Pkd1l1 G T 11: 8,929,430 H474N probably damaging Het
Pltp A G 2: 164,852,461 probably benign Het
Qtrt1 C T 9: 21,419,548 T324M probably benign Het
Racgap1 A T 15: 99,639,832 probably benign Het
Rhbg A G 3: 88,254,498 V50A probably benign Het
Rnf135 G A 11: 80,183,950 V12M probably damaging Het
Rufy2 T C 10: 62,993,170 V117A probably damaging Het
Safb A G 17: 56,605,630 M866V probably benign Het
Slc35c2 G T 2: 165,280,815 T183K probably damaging Het
Slc39a7 A G 17: 34,029,538 L377P probably damaging Het
Slit1 G A 19: 41,608,311 probably benign Het
Spaca9 G A 2: 28,693,010 H133Y probably damaging Het
Spout1 A G 2: 30,174,971 F339S probably benign Het
St6gal2 A G 17: 55,482,014 I16M probably damaging Het
Stat2 T C 10: 128,276,509 M6T probably benign Het
Swt1 T A 1: 151,411,270 H157L probably benign Het
Syne2 A G 12: 76,038,940 N147D possibly damaging Het
Tmem2 A T 19: 21,797,345 N117I possibly damaging Het
Tmem222 A T 4: 133,277,591 M45K possibly damaging Het
Tmem30a T A 9: 79,777,285 H95L probably damaging Het
Tns3 A C 11: 8,547,262 probably benign Het
Trpm3 A G 19: 22,698,778 I103V probably benign Het
Ube2n T C 10: 95,541,344 F57S probably benign Het
Vil1 T C 1: 74,421,340 S219P possibly damaging Het
Wdfy4 A G 14: 33,140,738 probably benign Het
Wdr7 T C 18: 63,791,843 S966P probably benign Het
Wnt8a A G 18: 34,544,847 N103D probably damaging Het
Zfp523 G A 17: 28,200,445 E186K possibly damaging Het
Zfp791 A T 8: 85,109,980 D418E probably benign Het
Zscan20 A G 4: 128,591,889 V192A probably benign Het
Other mutations in Mthfd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Mthfd1l APN 10 3989971 synonymous probably benign
IGL01013:Mthfd1l APN 10 4030716 missense probably damaging 1.00
IGL01018:Mthfd1l APN 10 3978708 missense probably benign
IGL01018:Mthfd1l APN 10 4007800 missense probably benign
IGL01018:Mthfd1l APN 10 4032345 splice site probably benign
IGL01068:Mthfd1l APN 10 4028428 missense probably damaging 1.00
IGL01584:Mthfd1l APN 10 4016738 missense probably damaging 0.97
IGL01609:Mthfd1l APN 10 4018567 missense probably benign 0.00
IGL02272:Mthfd1l APN 10 4041812 missense probably damaging 0.99
IGL02344:Mthfd1l APN 10 4048272 splice site probably null
IGL02429:Mthfd1l APN 10 4089334 missense probably damaging 1.00
IGL02503:Mthfd1l APN 10 4083824 missense probably damaging 1.00
IGL02748:Mthfd1l APN 10 4018587 missense possibly damaging 0.94
IGL02748:Mthfd1l APN 10 3980268 critical splice donor site probably null
IGL03031:Mthfd1l APN 10 4018601 critical splice donor site probably null
IGL03047:Mthfd1l APN 10 3980409 splice site probably benign
IGL03215:Mthfd1l APN 10 4041826 missense probably benign 0.14
IGL03367:Mthfd1l APN 10 4106536 splice site probably benign
R0047:Mthfd1l UTSW 10 3978727 splice site probably benign
R0047:Mthfd1l UTSW 10 3978727 splice site probably benign
R0107:Mthfd1l UTSW 10 4041838 missense probably benign
R0348:Mthfd1l UTSW 10 4056766 missense probably damaging 1.00
R0658:Mthfd1l UTSW 10 4047976 splice site probably null
R1177:Mthfd1l UTSW 10 3985661 missense possibly damaging 0.82
R1676:Mthfd1l UTSW 10 4083877 critical splice donor site probably null
R1703:Mthfd1l UTSW 10 4148093 missense probably damaging 1.00
R1888:Mthfd1l UTSW 10 4106528 missense probably damaging 1.00
R1888:Mthfd1l UTSW 10 4106528 missense probably damaging 1.00
R1891:Mthfd1l UTSW 10 4032284 nonsense probably null
R2014:Mthfd1l UTSW 10 4047894 missense probably benign
R2061:Mthfd1l UTSW 10 4103288 missense probably benign 0.00
R2197:Mthfd1l UTSW 10 4028399 missense probably damaging 1.00
R2360:Mthfd1l UTSW 10 4056771 missense probably damaging 1.00
R3085:Mthfd1l UTSW 10 4090007 missense probably benign 0.00
R3176:Mthfd1l UTSW 10 4148025 missense probably damaging 1.00
R3276:Mthfd1l UTSW 10 4148025 missense probably damaging 1.00
R4065:Mthfd1l UTSW 10 4032242 missense probably damaging 1.00
R4612:Mthfd1l UTSW 10 4030717 missense probably damaging 1.00
R4803:Mthfd1l UTSW 10 4007840 missense possibly damaging 0.52
R4883:Mthfd1l UTSW 10 4007775 missense probably benign 0.11
R4932:Mthfd1l UTSW 10 3980241 missense probably benign 0.00
R5507:Mthfd1l UTSW 10 4106432 missense probably benign 0.20
R5687:Mthfd1l UTSW 10 3990002 splice site probably null
R5694:Mthfd1l UTSW 10 4035239 missense possibly damaging 0.90
R5727:Mthfd1l UTSW 10 4103302 missense possibly damaging 0.86
R5908:Mthfd1l UTSW 10 4089392 missense probably damaging 1.00
R5951:Mthfd1l UTSW 10 4048222 missense probably damaging 1.00
R6330:Mthfd1l UTSW 10 3980234 missense probably benign
R6583:Mthfd1l UTSW 10 4047937 missense probably damaging 0.96
R6846:Mthfd1l UTSW 10 4047898 missense probably damaging 1.00
R7105:Mthfd1l UTSW 10 4103261 missense probably benign
R7456:Mthfd1l UTSW 10 4089998 missense probably damaging 1.00
R7848:Mthfd1l UTSW 10 4083739 missense possibly damaging 0.81
R7931:Mthfd1l UTSW 10 4083739 missense possibly damaging 0.81
R8003:Mthfd1l UTSW 10 3984147 missense probably benign 0.00
R8073:Mthfd1l UTSW 10 3973417 missense probably benign 0.28
X0003:Mthfd1l UTSW 10 4089303 missense probably damaging 0.99
Z1088:Mthfd1l UTSW 10 4007844 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACACAGAGTCAATGAGCACCTGTC -3'
(R):5'- CATCATACAGGAACTGGAAGCGGC -3'

Sequencing Primer
(F):5'- tccagaggcagaggcag -3'
(R):5'- AACTGGAAGCGGCTTCTTTTATTC -3'
Posted On2013-05-29