Incidental Mutation 'R4849:Sec23b'
ID439421
Institutional Source Beutler Lab
Gene Symbol Sec23b
Ensembl Gene ENSMUSG00000027429
Gene NameSEC23 homolog B, COPII coat complex component
Synonyms
MMRRC Submission 042461-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4849 (G1)
Quality Score223
Status Validated
Chromosome2
Chromosomal Location144556229-144590749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144585599 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 582 (F582S)
Ref Sequence ENSEMBL: ENSMUSP00000028916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028916]
Predicted Effect probably damaging
Transcript: ENSMUST00000028916
AA Change: F582S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028916
Gene: ENSMUSG00000027429
AA Change: F582S

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 4.3e-17 PFAM
Pfam:Sec23_trunk 126 392 2.3e-82 PFAM
Pfam:Sec23_BS 403 506 7.2e-33 PFAM
Pfam:Sec23_helical 522 620 1.1e-28 PFAM
Pfam:Gelsolin 631 720 1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146487
Meta Mutation Damage Score 0.9747 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The function of this gene product has been implicated in cargo selection and concentration. Multiple alternatively spliced transcript variants have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display complete neonatal lethality, fail to suckle, and show degeneration of the secretory tissues in the pancreas, salivary gland, and gastric glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G T 7: 28,615,452 R239S possibly damaging Het
Angptl1 C A 1: 156,857,165 N301K probably benign Het
Ankrd26 T A 6: 118,532,296 T603S probably benign Het
App T C 16: 85,056,434 D252G unknown Het
Atxn3 A G 12: 101,934,368 S219P probably benign Het
Birc6 T C 17: 74,647,388 S3397P probably damaging Het
Bivm A G 1: 44,142,873 I414V possibly damaging Het
Cemip A G 7: 83,935,737 F1324L possibly damaging Het
Ckap5 T A 2: 91,615,271 N1724K probably damaging Het
Corin T A 5: 72,302,835 M1035L probably damaging Het
Ctnna3 T C 10: 64,873,315 I711T probably damaging Het
Cts6 A T 13: 61,201,601 W98R probably null Het
Dip2a A G 10: 76,294,533 S580P probably damaging Het
Dock6 A G 9: 21,811,772 probably null Het
Dusp15 T A 2: 152,949,082 T32S probably damaging Het
Eogt T A 6: 97,116,055 N387I probably damaging Het
Evx2 T C 2: 74,659,331 D29G probably benign Het
Fat1 A G 8: 45,012,970 N1422S probably benign Het
Fat2 T C 11: 55,310,637 D537G probably damaging Het
Fat3 A C 9: 16,377,948 I93S probably benign Het
Fem1b T C 9: 62,797,294 E228G probably damaging Het
Fh1 A G 1: 175,620,506 T25A probably benign Het
Fndc3b A G 3: 27,459,948 W695R probably damaging Het
Gaa G A 11: 119,272,987 V222I possibly damaging Het
Ggnbp1 T C 17: 27,032,973 probably null Het
Gipc1 A G 8: 83,662,127 Y154C probably benign Het
Gm5356 G T 8: 89,187,042 noncoding transcript Het
Gnl1 T A 17: 35,987,711 probably null Het
Gpcpd1 C T 2: 132,534,099 G605R probably damaging Het
Guca1a T C 17: 47,394,737 T177A possibly damaging Het
Ifit1bl1 T C 19: 34,594,676 E127G probably damaging Het
Ift81 A T 5: 122,591,219 I350N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A G 6: 125,043,983 R23G probably damaging Het
Ins1 A G 19: 52,264,946 N108S probably damaging Het
Iqce A T 5: 140,693,459 M72K possibly damaging Het
Itga3 C A 11: 95,076,271 M22I probably benign Het
Kctd18 T C 1: 57,961,993 E201G probably damaging Het
Klc1 A G 12: 111,781,695 N344S probably damaging Het
Klrb1f A T 6: 129,056,384 I192F probably damaging Het
Klrg2 A T 6: 38,630,279 probably null Het
Kntc1 A C 5: 123,759,065 I164L probably benign Het
Ltf T A 9: 111,025,990 I357K probably benign Het
Mr1 T C 1: 155,130,690 T304A probably benign Het
Msh6 C T 17: 87,983,519 R178C possibly damaging Het
Mtch1 T C 17: 29,347,591 D66G probably benign Het
Mtmr7 A G 8: 40,608,997 V15A probably benign Het
Mtss1l A T 8: 110,726,243 H40L possibly damaging Het
Mxra8 A G 4: 155,840,874 probably benign Het
Myo3b T C 2: 70,244,909 L535P probably damaging Het
Neurl2 T A 2: 164,832,819 probably null Het
Nfia A C 4: 98,081,811 T503P probably damaging Het
Noa1 T C 5: 77,306,332 E487G possibly damaging Het
Nuak1 A T 10: 84,375,279 V315D probably damaging Het
Nup205 A G 6: 35,230,570 N1519S possibly damaging Het
Olfr107 T C 17: 37,405,698 V50A probably benign Het
Olfr364-ps1 T C 2: 37,146,254 L14P probably damaging Het
Olfr417 T A 1: 174,369,400 I161K probably damaging Het
Olfr466 G A 13: 65,152,679 V152M possibly damaging Het
Olfr524 G T 7: 140,202,427 C114* probably null Het
Olfr585 A G 7: 103,098,319 I193V possibly damaging Het
Peli1 T A 11: 21,148,528 probably benign Het
Ppp6r1 A G 7: 4,643,207 L175P probably damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Prss30 T A 17: 23,972,795 I251F probably benign Het
Psme3 A T 11: 101,317,081 N21Y probably benign Het
Ptpra T C 2: 130,532,161 Y271H probably damaging Het
Ralgapa1 T A 12: 55,698,803 N1303Y probably damaging Het
Rims4 T C 2: 163,865,543 I121V probably benign Het
Rnf123 A T 9: 108,056,091 L1149Q probably damaging Het
Ryr3 T A 2: 112,908,462 L593F probably damaging Het
Sgpl1 T C 10: 61,104,518 K335R probably benign Het
Sirpa C T 2: 129,609,243 T141I probably damaging Het
Slit1 G T 19: 41,649,544 A270E probably benign Het
Snap91 T C 9: 86,792,560 T533A possibly damaging Het
Sphkap T G 1: 83,277,384 E881D probably benign Het
Sptan1 C A 2: 30,011,042 R1407S probably damaging Het
Tfdp1 A G 8: 13,373,895 T353A probably benign Het
Ttyh1 A G 7: 4,122,534 I62V possibly damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp398 T C 6: 47,859,512 I82T possibly damaging Het
Zp1 A G 19: 10,918,834 Y176H possibly damaging Het
Other mutations in Sec23b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Sec23b APN 2 144583770 critical splice donor site probably null
IGL00668:Sec23b APN 2 144559218 utr 5 prime probably benign
IGL00714:Sec23b APN 2 144559225 missense probably benign 0.33
IGL00914:Sec23b APN 2 144566864 missense probably damaging 1.00
IGL01084:Sec23b APN 2 144564589 missense possibly damaging 0.81
IGL01341:Sec23b APN 2 144585733 missense probably benign 0.00
IGL01377:Sec23b APN 2 144559237 missense probably damaging 0.97
IGL01634:Sec23b APN 2 144559230 missense probably damaging 0.96
IGL02321:Sec23b APN 2 144579405 critical splice donor site probably null
IGL03027:Sec23b APN 2 144587545 missense possibly damaging 0.55
IGL03064:Sec23b APN 2 144582032 missense probably benign 0.00
IGL03105:Sec23b APN 2 144582020 missense probably damaging 1.00
IGL03240:Sec23b APN 2 144566759 splice site probably benign
R0004:Sec23b UTSW 2 144564562 splice site probably benign
R0092:Sec23b UTSW 2 144566910 missense probably benign 0.21
R0409:Sec23b UTSW 2 144567912 missense probably benign 0.22
R0426:Sec23b UTSW 2 144568612 unclassified probably benign
R0441:Sec23b UTSW 2 144581997 missense probably damaging 1.00
R1034:Sec23b UTSW 2 144590338 missense possibly damaging 0.87
R1624:Sec23b UTSW 2 144567129 missense probably benign
R2020:Sec23b UTSW 2 144566944 missense possibly damaging 0.49
R2392:Sec23b UTSW 2 144585587 splice site probably null
R3946:Sec23b UTSW 2 144581973 missense probably benign
R4407:Sec23b UTSW 2 144574718 missense possibly damaging 0.53
R4448:Sec23b UTSW 2 144559251 missense probably benign 0.43
R4519:Sec23b UTSW 2 144582015 missense possibly damaging 0.86
R4522:Sec23b UTSW 2 144578366 missense possibly damaging 0.80
R4654:Sec23b UTSW 2 144572574 missense probably benign 0.33
R4876:Sec23b UTSW 2 144586361 splice site probably null
R4983:Sec23b UTSW 2 144581953 missense probably benign 0.06
R6169:Sec23b UTSW 2 144586974 missense probably damaging 1.00
R6702:Sec23b UTSW 2 144559189 splice site probably null
R6703:Sec23b UTSW 2 144559189 splice site probably null
R6748:Sec23b UTSW 2 144566794 missense probably damaging 1.00
R7238:Sec23b UTSW 2 144590338 missense possibly damaging 0.87
R7511:Sec23b UTSW 2 144590349 missense probably benign 0.30
R7845:Sec23b UTSW 2 144559396 missense possibly damaging 0.67
R7914:Sec23b UTSW 2 144564645 missense probably benign
R8177:Sec23b UTSW 2 144585623 missense probably benign 0.03
R8183:Sec23b UTSW 2 144559269 missense probably benign 0.08
R8238:Sec23b UTSW 2 144564648 missense probably benign 0.00
R8420:Sec23b UTSW 2 144559314 missense probably benign 0.01
R8488:Sec23b UTSW 2 144582063 missense probably damaging 0.98
R8558:Sec23b UTSW 2 144586388 missense possibly damaging 0.90
R8911:Sec23b UTSW 2 144559396 missense probably benign 0.27
R8939:Sec23b UTSW 2 144569217 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGTGTCCAGTAGAAGGCACTC -3'
(R):5'- ATGGCATTCTGAGGAAAGCGC -3'

Sequencing Primer
(F):5'- AGTAGAAGGCACTCTCTATTTCC -3'
(R):5'- AAAGCGCGTATGTCCGTTC -3'
Posted On2016-10-28