Incidental Mutation 'R4849:Mtch1'
ID439422
Institutional Source Beutler Lab
Gene Symbol Mtch1
Ensembl Gene ENSMUSG00000024012
Gene Namemitochondrial carrier 1
Synonyms2310034O17Rik
MMRRC Submission 042461-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4849 (G1)
Quality Score46
Status Validated
Chromosome17
Chromosomal Location29332072-29347904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29347591 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 66 (D66G)
Ref Sequence ENSEMBL: ENSMUSP00000113021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095427] [ENSMUST00000118366] [ENSMUST00000153658]
Predicted Effect probably benign
Transcript: ENSMUST00000095427
AA Change: D66G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093077
Gene: ENSMUSG00000024012
AA Change: D66G

DomainStartEndE-ValueType
low complexity region 9 64 N/A INTRINSIC
Pfam:Mito_carr 191 282 4e-10 PFAM
transmembrane domain 315 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118366
AA Change: D66G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113021
Gene: ENSMUSG00000024012
AA Change: D66G

DomainStartEndE-ValueType
low complexity region 9 64 N/A INTRINSIC
Pfam:Mito_carr 191 282 3.7e-10 PFAM
transmembrane domain 298 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132753
Predicted Effect probably benign
Transcript: ENSMUST00000153658
Meta Mutation Damage Score 0.0839 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitochondrial carrier family. The encoded protein is localized to the mitochondrion inner membrane and induces apoptosis independent of the proapoptotic proteins Bax and Bak. Pseudogenes on chromosomes 6 and 11 have been identified for this gene. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G T 7: 28,615,452 R239S possibly damaging Het
Angptl1 C A 1: 156,857,165 N301K probably benign Het
Ankrd26 T A 6: 118,532,296 T603S probably benign Het
App T C 16: 85,056,434 D252G unknown Het
Atxn3 A G 12: 101,934,368 S219P probably benign Het
Birc6 T C 17: 74,647,388 S3397P probably damaging Het
Bivm A G 1: 44,142,873 I414V possibly damaging Het
Cemip A G 7: 83,935,737 F1324L possibly damaging Het
Ckap5 T A 2: 91,615,271 N1724K probably damaging Het
Corin T A 5: 72,302,835 M1035L probably damaging Het
Ctnna3 T C 10: 64,873,315 I711T probably damaging Het
Cts6 A T 13: 61,201,601 W98R probably null Het
Dip2a A G 10: 76,294,533 S580P probably damaging Het
Dock6 A G 9: 21,811,772 probably null Het
Dusp15 T A 2: 152,949,082 T32S probably damaging Het
Eogt T A 6: 97,116,055 N387I probably damaging Het
Evx2 T C 2: 74,659,331 D29G probably benign Het
Fat1 A G 8: 45,012,970 N1422S probably benign Het
Fat2 T C 11: 55,310,637 D537G probably damaging Het
Fat3 A C 9: 16,377,948 I93S probably benign Het
Fem1b T C 9: 62,797,294 E228G probably damaging Het
Fh1 A G 1: 175,620,506 T25A probably benign Het
Fndc3b A G 3: 27,459,948 W695R probably damaging Het
Gaa G A 11: 119,272,987 V222I possibly damaging Het
Ggnbp1 T C 17: 27,032,973 probably null Het
Gipc1 A G 8: 83,662,127 Y154C probably benign Het
Gm5356 G T 8: 89,187,042 noncoding transcript Het
Gnl1 T A 17: 35,987,711 probably null Het
Gpcpd1 C T 2: 132,534,099 G605R probably damaging Het
Guca1a T C 17: 47,394,737 T177A possibly damaging Het
Ifit1bl1 T C 19: 34,594,676 E127G probably damaging Het
Ift81 A T 5: 122,591,219 I350N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A G 6: 125,043,983 R23G probably damaging Het
Ins1 A G 19: 52,264,946 N108S probably damaging Het
Iqce A T 5: 140,693,459 M72K possibly damaging Het
Itga3 C A 11: 95,076,271 M22I probably benign Het
Kctd18 T C 1: 57,961,993 E201G probably damaging Het
Klc1 A G 12: 111,781,695 N344S probably damaging Het
Klrb1f A T 6: 129,056,384 I192F probably damaging Het
Klrg2 A T 6: 38,630,279 probably null Het
Kntc1 A C 5: 123,759,065 I164L probably benign Het
Ltf T A 9: 111,025,990 I357K probably benign Het
Mr1 T C 1: 155,130,690 T304A probably benign Het
Msh6 C T 17: 87,983,519 R178C possibly damaging Het
Mtmr7 A G 8: 40,608,997 V15A probably benign Het
Mtss1l A T 8: 110,726,243 H40L possibly damaging Het
Mxra8 A G 4: 155,840,874 probably benign Het
Myo3b T C 2: 70,244,909 L535P probably damaging Het
Neurl2 T A 2: 164,832,819 probably null Het
Nfia A C 4: 98,081,811 T503P probably damaging Het
Noa1 T C 5: 77,306,332 E487G possibly damaging Het
Nuak1 A T 10: 84,375,279 V315D probably damaging Het
Nup205 A G 6: 35,230,570 N1519S possibly damaging Het
Olfr107 T C 17: 37,405,698 V50A probably benign Het
Olfr364-ps1 T C 2: 37,146,254 L14P probably damaging Het
Olfr417 T A 1: 174,369,400 I161K probably damaging Het
Olfr466 G A 13: 65,152,679 V152M possibly damaging Het
Olfr524 G T 7: 140,202,427 C114* probably null Het
Olfr585 A G 7: 103,098,319 I193V possibly damaging Het
Peli1 T A 11: 21,148,528 probably benign Het
Ppp6r1 A G 7: 4,643,207 L175P probably damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Prss30 T A 17: 23,972,795 I251F probably benign Het
Psme3 A T 11: 101,317,081 N21Y probably benign Het
Ptpra T C 2: 130,532,161 Y271H probably damaging Het
Ralgapa1 T A 12: 55,698,803 N1303Y probably damaging Het
Rims4 T C 2: 163,865,543 I121V probably benign Het
Rnf123 A T 9: 108,056,091 L1149Q probably damaging Het
Ryr3 T A 2: 112,908,462 L593F probably damaging Het
Sec23b T C 2: 144,585,599 F582S probably damaging Het
Sgpl1 T C 10: 61,104,518 K335R probably benign Het
Sirpa C T 2: 129,609,243 T141I probably damaging Het
Slit1 G T 19: 41,649,544 A270E probably benign Het
Snap91 T C 9: 86,792,560 T533A possibly damaging Het
Sphkap T G 1: 83,277,384 E881D probably benign Het
Sptan1 C A 2: 30,011,042 R1407S probably damaging Het
Tfdp1 A G 8: 13,373,895 T353A probably benign Het
Ttyh1 A G 7: 4,122,534 I62V possibly damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp398 T C 6: 47,859,512 I82T possibly damaging Het
Zp1 A G 19: 10,918,834 Y176H possibly damaging Het
Other mutations in Mtch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Mtch1 APN 17 29340456 missense probably damaging 1.00
IGL01104:Mtch1 APN 17 29336222 missense probably damaging 0.99
IGL02728:Mtch1 APN 17 29338742 missense possibly damaging 0.55
IGL02935:Mtch1 APN 17 29336210 missense probably benign
R0070:Mtch1 UTSW 17 29340059 splice site probably benign
R0070:Mtch1 UTSW 17 29340059 splice site probably benign
R0243:Mtch1 UTSW 17 29340106 missense possibly damaging 0.78
R1136:Mtch1 UTSW 17 29333770 splice site probably null
R1829:Mtch1 UTSW 17 29338776 missense probably damaging 1.00
R2156:Mtch1 UTSW 17 29342867 missense probably damaging 1.00
R3845:Mtch1 UTSW 17 29342832 missense probably damaging 1.00
R5436:Mtch1 UTSW 17 29347590 missense probably benign 0.44
R6234:Mtch1 UTSW 17 29340511 splice site probably null
R6983:Mtch1 UTSW 17 29338776 missense probably damaging 1.00
R7465:Mtch1 UTSW 17 29332724 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCCACGTCAATCACTCAG -3'
(R):5'- ACAGACTGAGACTCGTAGGC -3'

Sequencing Primer
(F):5'- GTCAATCACTCAGATCCCTCAG -3'
(R):5'- GCACGATTGCGGTGACTG -3'
Posted On2016-10-28