Incidental Mutation 'R4931:Kif13a'
ID439435
Institutional Source Beutler Lab
Gene Symbol Kif13a
Ensembl Gene ENSMUSG00000021375
Gene Namekinesin family member 13A
Synonyms4930505I07Rik, N-3 kinesin
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R4931 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location46749087-46929867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46809055 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 478 (I478T)
Ref Sequence ENSEMBL: ENSMUSP00000153614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056978
AA Change: I541T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: I541T

DomainStartEndE-ValueType
KISc 3 360 2.69e-175 SMART
low complexity region 368 381 N/A INTRINSIC
low complexity region 391 406 N/A INTRINSIC
FHA 469 519 7.16e-2 SMART
coiled coil region 605 639 N/A INTRINSIC
coiled coil region 664 704 N/A INTRINSIC
Pfam:KIF1B 748 792 1.7e-19 PFAM
low complexity region 840 854 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
Pfam:DUF3694 1003 1270 2.2e-39 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1475 1492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225591
AA Change: I478T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Kif13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Kif13a APN 13 46750634 splice site probably benign
IGL01433:Kif13a APN 13 46772908 missense probably damaging 1.00
IGL01528:Kif13a APN 13 46864837 splice site probably benign
IGL01536:Kif13a APN 13 46752289 missense probably damaging 0.96
IGL01620:Kif13a APN 13 46864820 missense probably benign
IGL02020:Kif13a APN 13 46794019 missense probably benign 0.05
IGL02142:Kif13a APN 13 46771535 missense probably benign 0.04
IGL02375:Kif13a APN 13 46825222 missense probably damaging 1.00
IGL02407:Kif13a APN 13 46785293 missense probably damaging 0.99
IGL02476:Kif13a APN 13 46785296 missense probably damaging 1.00
IGL03038:Kif13a APN 13 46772838 missense probably damaging 1.00
IGL03053:Kif13a APN 13 46752088 missense probably benign 0.01
IGL03366:Kif13a APN 13 46764623 missense probably benign 0.00
R0025:Kif13a UTSW 13 46786511 critical splice donor site probably null
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0135:Kif13a UTSW 13 46793943 missense probably damaging 0.99
R0137:Kif13a UTSW 13 46764603 missense probably benign 0.38
R0243:Kif13a UTSW 13 46791351 missense probably benign 0.24
R0346:Kif13a UTSW 13 46814219 missense possibly damaging 0.95
R0403:Kif13a UTSW 13 46791401 missense probably damaging 1.00
R0492:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0607:Kif13a UTSW 13 46802711 missense probably damaging 0.96
R0631:Kif13a UTSW 13 46778888 unclassified probably benign
R0654:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0697:Kif13a UTSW 13 46848337 missense probably benign 0.19
R0699:Kif13a UTSW 13 46799213 missense possibly damaging 0.92
R0715:Kif13a UTSW 13 46812823 missense probably damaging 0.98
R0834:Kif13a UTSW 13 46814236 missense probably damaging 0.96
R0903:Kif13a UTSW 13 46929259 missense possibly damaging 0.75
R1419:Kif13a UTSW 13 46825235 missense probably damaging 1.00
R1428:Kif13a UTSW 13 46791511 splice site probably benign
R1449:Kif13a UTSW 13 46812736 missense probably damaging 1.00
R1463:Kif13a UTSW 13 46929612 missense possibly damaging 0.75
R1541:Kif13a UTSW 13 46809213 missense probably benign
R1579:Kif13a UTSW 13 46752856 missense possibly damaging 0.93
R1582:Kif13a UTSW 13 46793922 missense probably benign 0.03
R1644:Kif13a UTSW 13 46793922 missense probably benign 0.31
R1752:Kif13a UTSW 13 46798409 missense probably damaging 1.00
R1755:Kif13a UTSW 13 46752613 missense possibly damaging 0.73
R1755:Kif13a UTSW 13 46773678 missense possibly damaging 0.50
R1858:Kif13a UTSW 13 46864838 splice site probably benign
R1891:Kif13a UTSW 13 46929219 missense possibly damaging 0.63
R1902:Kif13a UTSW 13 46788162 missense probably benign 0.00
R1928:Kif13a UTSW 13 46812745 missense probably damaging 1.00
R1960:Kif13a UTSW 13 46864838 splice site probably benign
R1961:Kif13a UTSW 13 46864838 splice site probably benign
R2016:Kif13a UTSW 13 46810799 missense probably benign 0.13
R2139:Kif13a UTSW 13 46752469 missense possibly damaging 0.92
R2174:Kif13a UTSW 13 46769176 missense probably damaging 0.99
R2407:Kif13a UTSW 13 46777097 missense probably damaging 1.00
R2504:Kif13a UTSW 13 46814200 missense probably damaging 1.00
R3122:Kif13a UTSW 13 46764596 splice site probably benign
R3499:Kif13a UTSW 13 46825339 missense probably damaging 1.00
R3905:Kif13a UTSW 13 46802690 missense probably damaging 1.00
R4474:Kif13a UTSW 13 46814155 splice site probably null
R4771:Kif13a UTSW 13 46825211 missense probably damaging 1.00
R4838:Kif13a UTSW 13 46826748 missense probably damaging 1.00
R4924:Kif13a UTSW 13 46929599 missense probably damaging 1.00
R4980:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R4992:Kif13a UTSW 13 46777163 missense probably damaging 0.96
R5047:Kif13a UTSW 13 46788085 missense probably benign 0.00
R5054:Kif13a UTSW 13 46802646 missense probably damaging 1.00
R5141:Kif13a UTSW 13 46752721 missense probably benign
R5329:Kif13a UTSW 13 46775401 critical splice donor site probably null
R5429:Kif13a UTSW 13 46772769 critical splice donor site probably null
R5499:Kif13a UTSW 13 46832736 missense probably damaging 1.00
R5509:Kif13a UTSW 13 46752115 missense probably benign 0.13
R5594:Kif13a UTSW 13 46752862 missense probably damaging 1.00
R5921:Kif13a UTSW 13 46825300 missense probably damaging 1.00
R5964:Kif13a UTSW 13 46771524 missense probably damaging 1.00
R6115:Kif13a UTSW 13 46801313 missense probably damaging 1.00
R6317:Kif13a UTSW 13 46826757 missense probably damaging 1.00
R6318:Kif13a UTSW 13 46815207 splice site probably null
R6393:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6394:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6395:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6735:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R7037:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7038:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7039:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7237:Kif13a UTSW 13 46809156 critical splice donor site probably null
R7285:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7286:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7287:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7341:Kif13a UTSW 13 46826745 missense probably damaging 1.00
X0013:Kif13a UTSW 13 46929270 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GACAGCTCTGCTTCTACACC -3'
(R):5'- AATGGCACCCTTGTCTGCAG -3'

Sequencing Primer
(F):5'- GTCCCTCAGAGATGACATAGGC -3'
(R):5'- ACAACTTCACGCTCTCTA -3'
Posted On2016-10-28