Mutagenetix > Incidental Mutation

Incidental Mutation 'R4842:Chrna7'

439443

Institutional Source

Beutler Lab

Gene Symbol

Chrna7

Ensembl Gene

ENSMUSG00000030525

Gene Name

cholinergic receptor, nicotinic, alpha polypeptide 7

Synonyms

alpha7-nAChR, alpha7, Acra7, alpha7 nicotinic receptor

MMRRC Submission

042455-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4842 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

63098692-63212569 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 63212448 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 10 (L10R)

Ref Sequence

ENSEMBL: ENSMUSP00000032738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032738]

AlphaFold

P49582

Predicted Effect

probably benign
Transcript: ENSMUST00000032738
AA Change: L10R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000032738
Gene: ENSMUSG00000030525
AA Change: L10R

Domain	Start	End	E-Value	Type
low complexity region	10	17	N/A	INTRINSIC
Pfam:Neur_chan_LBD	26	230	1e-75	PFAM
Pfam:Neur_chan_memb	237	487	3.6e-63	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208304

Meta Mutation Damage Score

0.5815

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

95% (107/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice lack hippocampal fast nicotinic currents but show nicotine-induced seizures as well as altered anxiety behavior, fertility defects, airway basal cell hyperplasia. and higher TNF sythesis when endotoxemic. Newborns homozygous for a knock-in allele die with increased neuron apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012H06Rik	A	T	17: 14,943,739	I43L	possibly damaging	Het
4930449A18Rik	T	A	3: 59,841,732		noncoding transcript	Het
9530053A07Rik	T	A	7: 28,150,722	C1198S	probably damaging	Het
Abcc8	T	C	7: 46,150,828	K510R	probably damaging	Het
Adamtsl3	C	T	7: 82,528,861	R511C	probably damaging	Het
Arhgap11a	T	C	2: 113,839,762	S339G	probably damaging	Het
C2cd3	A	G	7: 100,416,190	T728A	probably benign	Het
Cand1	C	A	10: 119,213,546		probably null	Het
Catspere1	A	T	1: 177,872,058		noncoding transcript	Het
Cd209c	G	T	8: 3,945,905	R2S	probably benign	Het
Cdc16	A	G	8: 13,781,644		probably benign	Het
Ces1g	C	T	8: 93,333,695	E99K	probably benign	Het
Clnk	C	T	5: 38,713,069		probably null	Het
Cntrob	C	G	11: 69,315,394	L315F	possibly damaging	Het
Ctdp1	A	G	18: 80,408,726	S145P	unknown	Het
Dennd2a	T	C	6: 39,497,110	D430G	probably damaging	Het
Dnajc16	A	G	4: 141,774,625	F298S	probably damaging	Het
Dock5	T	C	14: 67,817,563	D618G	probably damaging	Het
Drc3	G	A	11: 60,370,535	A171T	probably benign	Het
Ecel1	A	T	1: 87,153,301	N322K	probably damaging	Het
Eftud2	A	G	11: 102,854,814	F362L	probably damaging	Het
Egfr	C	T	11: 16,911,607	H1129Y	probably benign	Het
Eif2b1	A	G	5: 124,576,908	S102P	probably damaging	Het
Erich3	T	A	3: 154,704,843	F112I	possibly damaging	Het
Fam107b	T	C	2: 3,778,543	L261S	probably damaging	Het
Fam198b	G	A	3: 79,936,605	R377H	probably damaging	Het
Fat3	A	C	9: 15,997,587	V2373G	probably damaging	Het
Gadd45a	A	T	6: 67,036,889	L58Q	probably damaging	Het
Gipr	C	T	7: 19,162,676	R165H	probably damaging	Het
Gje1	C	T	10: 14,717,338	G45R	probably null	Het
Gldc	T	A	19: 30,133,732	N548I	possibly damaging	Het
Gm13035	A	G	4: 146,073,423		noncoding transcript	Het
Gm27013	T	A	6: 130,520,737		noncoding transcript	Het
Gm5436	A	T	12: 84,258,810		noncoding transcript	Het
Gm6588	A	T	5: 112,450,240	K218*	probably null	Het
Grik3	C	A	4: 125,691,176	N612K	probably damaging	Het
Hfm1	C	A	5: 106,892,751	W716L	probably damaging	Het
Hist1h2bl	C	T	13: 21,716,064		probably benign	Het
Il5ra	T	C	6: 106,738,375	Y166C	probably damaging	Het
Iqcb1	A	G	16: 36,835,590	E113G	probably benign	Het
Kcnk10	A	T	12: 98,434,916	M486K	probably benign	Het
Kcnv2	A	G	19: 27,323,790	D347G	probably damaging	Het
Kif21b	C	A	1: 136,145,220	H119N	probably damaging	Het
Lamb1	C	T	12: 31,287,433	H388Y	probably damaging	Het
Leng9	T	C	7: 4,149,386	D97G	probably damaging	Het
Lmbr1	G	A	5: 29,287,426	T55I	probably damaging	Het
Lrp1	G	T	10: 127,583,936	R935S	probably damaging	Het
Lrp2	A	T	2: 69,469,411	V3099E	probably benign	Het
Lrrcc1	C	A	3: 14,562,511	D503E	probably benign	Het
Map1a	T	A	2: 121,302,086	S890T	probably damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Mybph	A	T	1: 134,198,495	E349V	probably damaging	Het
Myh7b	C	A	2: 155,633,989	L1935M	probably benign	Het
Myh9	T	C	15: 77,769,253	E1348G	probably damaging	Het
Myzap	A	G	9: 71,548,755	S328P	probably damaging	Het
Nbeal1	T	C	1: 60,253,375	L1062P	probably damaging	Het
Nepro	G	A	16: 44,734,797	S412N	probably null	Het
Nr1h3	A	G	2: 91,190,218	F257L	probably benign	Het
Nudt5	T	C	2: 5,864,428	V155A	probably benign	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr522	A	G	7: 140,162,689	L87P	possibly damaging	Het
Olfr539	A	T	7: 140,667,589	I94F	probably damaging	Het
Olfr653	A	T	7: 104,580,215	I190L	probably benign	Het
Pde1a	T	A	2: 80,128,837		probably benign	Het
Pde4dip	T	A	3: 97,793,528	H220L	probably damaging	Het
Pde9a	T	A	17: 31,443,161		probably null	Het
Pnkp	C	A	7: 44,861,646		probably null	Het
Pnpla7	A	G	2: 24,980,052	T15A	probably benign	Het
Polq	G	T	16: 37,048,783		probably null	Het
Ppfia2	C	T	10: 106,854,957	T553I	probably benign	Het
Ptk6	T	G	2: 181,196,991	N323T	possibly damaging	Het
Rhox3c	G	A	X: 37,470,424	A60T	probably damaging	Het
Rnf4	T	A	5: 34,348,709	V61E	probably damaging	Het
Rnf5	A	G	17: 34,602,003		probably benign	Het
Sardh	A	G	2: 27,191,955	V853A	probably benign	Het
Scfd1	T	C	12: 51,389,326	V86A	probably damaging	Het
Scube3	G	A	17: 28,164,123	C425Y	probably damaging	Het
Sema5a	C	T	15: 32,609,417	H490Y	probably benign	Het
Sfta2	T	C	17: 35,649,881		probably benign	Het
Sh3d19	T	C	3: 86,123,742	Y738H	probably damaging	Het
Shc2	T	C	10: 79,622,461	R463G	probably damaging	Het
Socs7	T	A	11: 97,377,003	I320N	possibly damaging	Het
Speer2	A	T	16: 69,858,100	M159K	probably benign	Het
Sppl2c	A	C	11: 104,187,652	H426P	probably benign	Het
Stag3	T	G	5: 138,309,365		probably null	Het
Stxbp5	C	A	10: 9,762,891	V1055L	probably benign	Het
Synpo	A	T	18: 60,603,612	S421T	probably damaging	Het
Taf6l	A	G	19: 8,782,406	V135A	possibly damaging	Het
Tas2r116	G	A	6: 132,855,697	S87N	probably benign	Het
Tomm6	T	C	17: 47,688,069		probably benign	Het
Trabd	T	C	15: 89,082,712	M113T	probably benign	Het
Trim58	G	A	11: 58,651,324	G370E	probably damaging	Het
Ttc41	C	T	10: 86,731,125	R552C	probably benign	Het
Vit	T	C	17: 78,601,879	S252P	probably benign	Het
Vma21-ps	T	A	4: 52,496,943	D101V	probably damaging	Het
Vmn1r173	A	T	7: 23,702,936	I199F	probably damaging	Het
Vmn2r114	T	A	17: 23,310,362	R255S	probably benign	Het
Vmn2r17	A	G	5: 109,434,380	N545S	probably damaging	Het
Zfp865	A	G	7: 5,031,641	Y875C	probably damaging	Het

Other mutations in Chrna7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01776:Chrna7	APN	7	63099519	missense	probably benign	0.01
IGL01999:Chrna7	APN	7	63103791	missense	probably damaging	1.00
IGL02016:Chrna7	APN	7	63103835	missense	probably damaging	1.00
IGL02388:Chrna7	APN	7	63107691	missense	probably damaging	1.00
IGL02400:Chrna7	APN	7	63099322	missense	probably damaging	1.00
IGL02458:Chrna7	APN	7	63106094	missense	probably damaging	1.00
IGL03039:Chrna7	APN	7	63148592	missense	probably damaging	1.00
inflation	UTSW	7	63148601	missense	probably damaging	1.00
thaler	UTSW	7	63106027	missense	probably damaging	1.00
R0034:Chrna7	UTSW	7	63148606	missense	possibly damaging	0.79
R0631:Chrna7	UTSW	7	63099643	missense	probably benign	0.00
R1666:Chrna7	UTSW	7	63212142	missense	possibly damaging	0.70
R1703:Chrna7	UTSW	7	63099507	missense	probably damaging	0.99
R1763:Chrna7	UTSW	7	63099252	missense	probably benign	0.05
R1974:Chrna7	UTSW	7	63099286	missense	probably damaging	1.00
R2294:Chrna7	UTSW	7	63110424	missense	probably benign	0.11
R2393:Chrna7	UTSW	7	63099246	missense	probably damaging	1.00
R4598:Chrna7	UTSW	7	63103790	missense	probably damaging	1.00
R4599:Chrna7	UTSW	7	63103790	missense	probably damaging	1.00
R5143:Chrna7	UTSW	7	63106147	missense	probably damaging	1.00
R5310:Chrna7	UTSW	7	63106057	missense	probably damaging	1.00
R5339:Chrna7	UTSW	7	63099307	missense	probably damaging	1.00
R5516:Chrna7	UTSW	7	63099298	missense	probably damaging	0.98
R5807:Chrna7	UTSW	7	63148601	missense	probably damaging	1.00
R6501:Chrna7	UTSW	7	63106115	missense	probably damaging	1.00
R6918:Chrna7	UTSW	7	63159551	missense	probably benign	0.03
R7000:Chrna7	UTSW	7	63106039	missense	probably damaging	1.00
R7189:Chrna7	UTSW	7	63106027	missense	probably damaging	1.00
R7483:Chrna7	UTSW	7	63104990	missense	probably damaging	1.00
R7953:Chrna7	UTSW	7	63103793	missense	possibly damaging	0.82
R7955:Chrna7	UTSW	7	63103793	missense	possibly damaging	0.82
R7956:Chrna7	UTSW	7	63103793	missense	possibly damaging	0.82
R8235:Chrna7	UTSW	7	63212224	missense	probably damaging	1.00
R9125:Chrna7	UTSW	7	63107609	nonsense	probably null
R9356:Chrna7	UTSW	7	63107689	missense	probably damaging	1.00
R9694:Chrna7	UTSW	7	63105061	missense	probably damaging	1.00
Z1176:Chrna7	UTSW	7	63212184	missense	probably damaging	1.00
Z1177:Chrna7	UTSW	7	63107551	critical splice donor site	probably null
Z1191:Chrna7	UTSW	7	63106193	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- ACACTTAGGAAGCAGAGCGC -3'
(R):5'- TCAACTAGCTGAGCAGGGATG -3'

Sequencing Primer
(F):5'- AGCCGCAACCCGGGAcca -3'
(R):5'- TGAGCAGGGATGCAGTTCC -3'

Posted On

2016-10-28