Incidental Mutation 'R5014:Zfp184'
ID439469
Institutional Source Beutler Lab
Gene Symbol Zfp184
Ensembl Gene ENSMUSG00000006720
Gene Namezinc finger protein 184 (Kruppel-like)
Synonyms
MMRRC Submission 042605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5014 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21945094-21960779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21958424 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 100 (D100G)
Ref Sequence ENSEMBL: ENSMUSP00000135173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006903] [ENSMUST00000102978] [ENSMUST00000176511] [ENSMUST00000176580]
Predicted Effect probably benign
Transcript: ENSMUST00000006903
AA Change: D100G

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000006903
Gene: ENSMUSG00000006720
AA Change: D100G

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102978
AA Change: D100G

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100043
Gene: ENSMUSG00000006720
AA Change: D100G

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176003
Predicted Effect probably benign
Transcript: ENSMUST00000176511
AA Change: D100G

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135173
Gene: ENSMUSG00000006720
AA Change: D100G

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176580
SMART Domains Protein: ENSMUSP00000135404
Gene: ENSMUSG00000006720

DomainStartEndE-ValueType
KRAB 28 84 1.96e-17 SMART
Meta Mutation Damage Score 0.0873 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to be a Kruppel C2H2-type zinc-finger protein family member. Sequence analysis predicts that the protein contains two Kruppel associated box (KRAB) boxes in the N-terminus and highly conserved zinc finger motifs at the C-terminus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Zfp184
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Zfp184 APN 13 21950225 splice site probably benign
R0393:Zfp184 UTSW 13 21947082 splice site probably benign
R0636:Zfp184 UTSW 13 21949749 missense probably damaging 1.00
R1657:Zfp184 UTSW 13 21959273 missense probably damaging 1.00
R1718:Zfp184 UTSW 13 21959272 missense possibly damaging 0.76
R4237:Zfp184 UTSW 13 21958778 missense probably damaging 1.00
R4326:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4327:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4328:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4877:Zfp184 UTSW 13 21960328 missense possibly damaging 0.92
R4941:Zfp184 UTSW 13 21949721 missense probably damaging 1.00
R5054:Zfp184 UTSW 13 21959282 missense possibly damaging 0.74
R5105:Zfp184 UTSW 13 21959629 missense possibly damaging 0.58
R5216:Zfp184 UTSW 13 21950236 missense probably damaging 1.00
R5379:Zfp184 UTSW 13 21959881 missense probably damaging 1.00
R5387:Zfp184 UTSW 13 21949640 intron probably benign
R5490:Zfp184 UTSW 13 21958577 missense probably benign 0.40
R6220:Zfp184 UTSW 13 21960207 missense probably damaging 1.00
R6752:Zfp184 UTSW 13 21959408 missense probably damaging 0.99
R7088:Zfp184 UTSW 13 21959992 missense probably damaging 1.00
R7653:Zfp184 UTSW 13 21959717 missense probably damaging 1.00
R8056:Zfp184 UTSW 13 21958838 missense probably damaging 1.00
X0057:Zfp184 UTSW 13 21959548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTTAGAGATCATCTGTGAAACTG -3'
(R):5'- CTCACACTGAGGTTGCTCTCAC -3'

Sequencing Primer
(F):5'- ACTGAAATAAGCATTCTTTTCCCTG -3'
(R):5'- CACTGAGGTTGCTCTCACAAGTG -3'
Posted On2016-10-31