Incidental Mutation 'R5014:Ints6'
ID439470
Institutional Source Beutler Lab
Gene Symbol Ints6
Ensembl Gene ENSMUSG00000035161
Gene Nameintegrator complex subunit 6
SynonymsDICE1, Notch2l, Ddx26, 2900075H24Rik
MMRRC Submission 042605-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5014 (G1)
Quality Score71
Status Validated
Chromosome14
Chromosomal Location62676330-62761169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62760191 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 55 (F55Y)
Ref Sequence ENSEMBL: ENSMUSP00000152954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053959] [ENSMUST00000223585]
Predicted Effect probably benign
Transcript: ENSMUST00000053959
AA Change: F55Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086788
Gene: ENSMUSG00000035161
AA Change: F55Y

DomainStartEndE-ValueType
VWA 1 158 4.11e-1 SMART
Blast:VWA 307 331 1e-7 BLAST
Blast:RRM_2 701 727 3e-8 BLAST
Pfam:INT_SG_DDX_CT_C 803 865 4e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181344
Predicted Effect probably benign
Transcript: ENSMUST00000223585
AA Change: F55Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225406
Meta Mutation Damage Score 0.0650 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. The protein encoded by this gene is a DEAD box protein that is part of a complex that interacts with the C-terminus of RNA polymerase II and is involved in 3' end processing of snRNAs. In addition, this gene is a candidate tumor suppressor and is located in the critical region of loss of heterozygosity (LOH). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Ints6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Ints6 APN 14 62703179 missense probably damaging 1.00
IGL00763:Ints6 APN 14 62700865 splice site probably benign
IGL01624:Ints6 APN 14 62696871 missense probably benign 0.07
IGL01721:Ints6 APN 14 62713739 missense probably damaging 0.96
IGL02146:Ints6 APN 14 62759260 missense possibly damaging 0.91
R0302:Ints6 UTSW 14 62709512 missense probably damaging 1.00
R0320:Ints6 UTSW 14 62707635 nonsense probably null
R0543:Ints6 UTSW 14 62696611 missense probably damaging 1.00
R0554:Ints6 UTSW 14 62704751 missense possibly damaging 0.87
R0620:Ints6 UTSW 14 62696759 missense probably benign
R0960:Ints6 UTSW 14 62709566 missense probably benign 0.39
R1216:Ints6 UTSW 14 62707698 missense probably damaging 1.00
R1254:Ints6 UTSW 14 62716374 missense probably benign 0.27
R1296:Ints6 UTSW 14 62704903 splice site probably benign
R1548:Ints6 UTSW 14 62713692 missense probably damaging 1.00
R1944:Ints6 UTSW 14 62693640 missense probably benign 0.03
R2040:Ints6 UTSW 14 62713689 missense probably damaging 0.99
R2279:Ints6 UTSW 14 62704682 critical splice donor site probably null
R2844:Ints6 UTSW 14 62704826 missense probably damaging 0.97
R3107:Ints6 UTSW 14 62760592 missense possibly damaging 0.92
R3407:Ints6 UTSW 14 62696937 missense probably benign 0.00
R3895:Ints6 UTSW 14 62696611 missense probably damaging 1.00
R4608:Ints6 UTSW 14 62703229 missense probably damaging 1.00
R4903:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R4964:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R4966:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R5369:Ints6 UTSW 14 62743935 missense probably damaging 1.00
R6478:Ints6 UTSW 14 62700786 missense probably benign 0.37
R7022:Ints6 UTSW 14 62714337 missense probably damaging 1.00
R7403:Ints6 UTSW 14 62707655 missense possibly damaging 0.50
R7422:Ints6 UTSW 14 62704775 missense probably benign
R7909:Ints6 UTSW 14 62759330 missense probably damaging 0.99
R7990:Ints6 UTSW 14 62759330 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTTGATCGTAGCGCCTC -3'
(R):5'- TGAAGGTACCGACTAACCCAGC -3'

Sequencing Primer
(F):5'- TGGGCCAGAAACTGCCAC -3'
(R):5'- GGTTTACTGCGGGCTCC -3'
Posted On2016-10-31