Incidental Mutation 'R5014:Ppp2r1a'
ID439471
Institutional Source Beutler Lab
Gene Symbol Ppp2r1a
Ensembl Gene ENSMUSG00000007564
Gene Nameprotein phosphatase 2, regulatory subunit A, alpha
SynonymsPR65, PP2A, 6330556D22Rik, protein phosphatase PP2A
MMRRC Submission 042605-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5014 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20945311-20965916 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 20958839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007708] [ENSMUST00000147983] [ENSMUST00000173658]
Predicted Effect probably null
Transcript: ENSMUST00000007708
SMART Domains Protein: ENSMUSP00000007708
Gene: ENSMUSG00000007564

DomainStartEndE-ValueType
Pfam:HEAT 166 196 4.3e-6 PFAM
Pfam:HEAT_2 170 266 1.7e-8 PFAM
Pfam:HEAT 283 313 3.4e-5 PFAM
Pfam:HEAT_2 366 467 5.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139293
Predicted Effect probably null
Transcript: ENSMUST00000147983
SMART Domains Protein: ENSMUSP00000133334
Gene: ENSMUSG00000007564

DomainStartEndE-ValueType
Pfam:HEAT 13 43 2.1e-5 PFAM
Pfam:HEAT 52 82 2.9e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173359
Predicted Effect probably benign
Transcript: ENSMUST00000173658
SMART Domains Protein: ENSMUSP00000133778
Gene: ENSMUSG00000007564

DomainStartEndE-ValueType
PDB:2PF4|D 1 72 3e-40 PDB
SCOP:d1b3ua_ 2 86 3e-12 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes an alpha isoform of the constant regulatory subunit A. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a targeted allele that remove exons 5 and 6 exhibit embryonic lethality. Mice heterozygous for this allele exhibit increased benzopyrene-induced lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Ppp2r1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ppp2r1a APN 17 20961578 unclassified probably benign
IGL01815:Ppp2r1a APN 17 20956832 missense probably benign 0.00
IGL01923:Ppp2r1a APN 17 20965469 makesense probably null
IGL02411:Ppp2r1a APN 17 20951334 splice site probably benign
IGL02694:Ppp2r1a APN 17 20951440 splice site probably benign
IGL02742:Ppp2r1a APN 17 20959003 missense probably benign 0.01
Dolmas UTSW 17 20960631 nonsense probably null
R0032:Ppp2r1a UTSW 17 20945584 critical splice donor site probably benign
R0403:Ppp2r1a UTSW 17 20957041 missense probably damaging 0.96
R1170:Ppp2r1a UTSW 17 20951331 splice site probably benign
R1652:Ppp2r1a UTSW 17 20955974 missense probably benign 0.03
R1857:Ppp2r1a UTSW 17 20961689 missense possibly damaging 0.93
R2215:Ppp2r1a UTSW 17 20961743 splice site probably null
R3800:Ppp2r1a UTSW 17 20962710 missense possibly damaging 0.82
R4013:Ppp2r1a UTSW 17 20951347 missense probably damaging 1.00
R4483:Ppp2r1a UTSW 17 20955810 missense probably benign 0.05
R5421:Ppp2r1a UTSW 17 20956706 missense probably benign
R5615:Ppp2r1a UTSW 17 20958987 missense probably benign 0.00
R5945:Ppp2r1a UTSW 17 20959413 missense possibly damaging 0.81
R5986:Ppp2r1a UTSW 17 20951346 missense probably damaging 1.00
R6466:Ppp2r1a UTSW 17 20960631 nonsense probably null
R6727:Ppp2r1a UTSW 17 20955825 missense probably benign 0.07
R6738:Ppp2r1a UTSW 17 20954717 critical splice donor site probably null
R6934:Ppp2r1a UTSW 17 20961633 missense possibly damaging 0.56
R7549:Ppp2r1a UTSW 17 20962682 missense possibly damaging 0.95
R7904:Ppp2r1a UTSW 17 20961741 critical splice donor site probably null
R7987:Ppp2r1a UTSW 17 20961741 critical splice donor site probably null
R7998:Ppp2r1a UTSW 17 20961639 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TAGCCCTGAGTGATTGCCAG -3'
(R):5'- AAAGGCCTTGGATCTGATTGTATC -3'

Sequencing Primer
(F):5'- AGTGATTGCCAGACTCTTCAG -3'
(R):5'- ACTCTATTACCTTGATGCAGGGCAAG -3'
Posted On2016-10-31