Incidental Mutation 'R5616:Tsc22d2'
ID439523
Institutional Source Beutler Lab
Gene Symbol Tsc22d2
Ensembl Gene ENSMUSG00000027806
Gene NameTSC22 domain family, member 2
Synonyms
MMRRC Submission 043159-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R5616 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location58414715-58466783 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 58417162 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000099090] [ENSMUST00000199164]
Predicted Effect unknown
Transcript: ENSMUST00000099090
AA Change: V492L
SMART Domains Protein: ENSMUSP00000096688
Gene: ENSMUSG00000027806
AA Change: V492L

DomainStartEndE-ValueType
low complexity region 95 145 N/A INTRINSIC
low complexity region 204 223 N/A INTRINSIC
low complexity region 253 286 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 377 400 N/A INTRINSIC
low complexity region 426 439 N/A INTRINSIC
low complexity region 441 457 N/A INTRINSIC
low complexity region 459 521 N/A INTRINSIC
low complexity region 531 541 N/A INTRINSIC
Pfam:TSC22 683 739 4.1e-29 PFAM
low complexity region 746 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196049
Predicted Effect unknown
Transcript: ENSMUST00000199164
AA Change: V492L
SMART Domains Protein: ENSMUSP00000143364
Gene: ENSMUSG00000027806
AA Change: V492L

DomainStartEndE-ValueType
low complexity region 95 145 N/A INTRINSIC
low complexity region 204 223 N/A INTRINSIC
low complexity region 253 286 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 377 400 N/A INTRINSIC
low complexity region 426 439 N/A INTRINSIC
low complexity region 441 457 N/A INTRINSIC
low complexity region 459 521 N/A INTRINSIC
low complexity region 531 541 N/A INTRINSIC
Pfam:TSC22 659 718 1.2e-28 PFAM
low complexity region 722 740 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199784
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,772,360 D443E probably benign Het
Arhgef5 A G 6: 43,275,940 D1037G probably benign Het
B3glct T A 5: 149,729,934 L148* probably null Het
Cacna1e G A 1: 154,442,194 P1481S probably damaging Het
Cacna1h C A 17: 25,377,667 R117L probably damaging Het
Cct6b A T 11: 82,741,349 V271E probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Cul1 G A 6: 47,523,788 R707H probably damaging Het
Dcakd A G 11: 102,995,005 L191P possibly damaging Het
Dhx32 T C 7: 133,721,228 *612W probably null Het
Disp1 T A 1: 183,088,349 T836S probably benign Het
Dppa4 T A 16: 48,291,030 V126D probably damaging Het
Fam98b A G 2: 117,267,786 T246A possibly damaging Het
Fkbp4 A T 6: 128,433,554 V273E probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr31b A G 17: 13,051,944 Y113H probably damaging Het
Gpr33 T C 12: 52,023,594 I221V probably damaging Het
Klhl1 A G 14: 96,518,293 F9L probably benign Het
Larp4b T A 13: 9,158,659 N449K probably damaging Het
Loxhd1 T C 18: 77,404,951 S1363P probably damaging Het
Lrrc8a T C 2: 30,255,354 V60A probably benign Het
Matn3 A G 12: 8,948,195 H51R probably benign Het
Mtrf1 T C 14: 79,401,445 C6R possibly damaging Het
Myh6 T C 14: 54,956,581 S784G probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nipal3 T C 4: 135,452,404 Y401C probably benign Het
Pcdhb20 A G 18: 37,504,532 E37G probably damaging Het
Pelp1 G A 11: 70,394,862 P727S possibly damaging Het
Prkca T C 11: 107,978,343 D472G possibly damaging Het
Ptprg A G 14: 12,122,120 H328R probably benign Het
Rtl1 C T 12: 109,592,739 E889K unknown Het
Rubcn T C 16: 32,826,923 D715G possibly damaging Het
Snurf C T 7: 59,999,385 E15K possibly damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Srp72 T G 5: 76,987,934 L237R probably damaging Het
Syne3 T C 12: 104,955,678 E406G probably damaging Het
Tgm2 A G 2: 158,128,720 S340P probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Tsc22d1 T C 14: 76,416,217 probably benign Het
Vmn1r42 T C 6: 89,845,102 I162V possibly damaging Het
Vmn2r59 A G 7: 42,058,767 probably null Het
Wnt3 T C 11: 103,812,770 probably null Het
Other mutations in Tsc22d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tsc22d2 APN 3 58417415 unclassified probably benign
IGL01389:Tsc22d2 APN 3 58416238 missense probably damaging 0.98
IGL01407:Tsc22d2 APN 3 58416503 missense probably damaging 0.99
IGL02193:Tsc22d2 APN 3 58460207 utr 3 prime probably benign
IGL02641:Tsc22d2 APN 3 58416155 missense probably damaging 1.00
IGL02956:Tsc22d2 APN 3 58417546 missense unknown
R0141:Tsc22d2 UTSW 3 58417156 unclassified probably benign
R0421:Tsc22d2 UTSW 3 58417328 unclassified probably benign
R1743:Tsc22d2 UTSW 3 58417539 frame shift probably null
R2214:Tsc22d2 UTSW 3 58416206 missense probably damaging 1.00
R5155:Tsc22d2 UTSW 3 58417316 unclassified probably benign
R5242:Tsc22d2 UTSW 3 58415939 missense possibly damaging 0.86
R6119:Tsc22d2 UTSW 3 58460253 utr 3 prime probably benign
R6454:Tsc22d2 UTSW 3 58415840 missense possibly damaging 0.92
R6855:Tsc22d2 UTSW 3 58416814 missense probably damaging 0.99
R6885:Tsc22d2 UTSW 3 58416208 missense probably damaging 1.00
R7148:Tsc22d2 UTSW 3 58417008 nonsense probably null
R7243:Tsc22d2 UTSW 3 58416463 missense unknown
R8078:Tsc22d2 UTSW 3 58416032 missense probably benign 0.04
R8309:Tsc22d2 UTSW 3 58417123 missense unknown
R8789:Tsc22d2 UTSW 3 58460017 nonsense probably null
Z1176:Tsc22d2 UTSW 3 58417024 missense unknown
Predicted Primers PCR Primer
(F):5'- ATACCACCCGGGCATTTGTTG -3'
(R):5'- TGAACCAACTTGCTGGATGAC -3'

Sequencing Primer
(F):5'- ATCCGGCCAGAGTGAGTAC -3'
(R):5'- AACTTGCTGGATGACGCTGC -3'
Posted On2016-11-08