Incidental Mutation 'R5616:Nipal3'
ID439525
Institutional Source Beutler Lab
Gene Symbol Nipal3
Ensembl Gene ENSMUSG00000028803
Gene NameNIPA-like domain containing 3
Synonyms9130020G22Rik, Npal3
MMRRC Submission 043159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5616 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location135445420-135495038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135452404 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 401 (Y401C)
Ref Sequence ENSEMBL: ENSMUSP00000099608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102549] [ENSMUST00000105856] [ENSMUST00000183807]
Predicted Effect probably benign
Transcript: ENSMUST00000102549
AA Change: Y401C

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099608
Gene: ENSMUSG00000028803
AA Change: Y401C

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 33 333 5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105856
SMART Domains Protein: ENSMUSP00000101482
Gene: ENSMUSG00000028803

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:Mg_trans_NIPA 35 330 9.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140982
SMART Domains Protein: ENSMUSP00000118178
Gene: ENSMUSG00000028803

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 1 190 1.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183397
Predicted Effect probably benign
Transcript: ENSMUST00000183807
SMART Domains Protein: ENSMUSP00000139088
Gene: ENSMUSG00000028803

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 33 333 3.8e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194277
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit gender-dependent behavioral and immune system abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,772,360 D443E probably benign Het
Arhgef5 A G 6: 43,275,940 D1037G probably benign Het
B3glct T A 5: 149,729,934 L148* probably null Het
Cacna1e G A 1: 154,442,194 P1481S probably damaging Het
Cacna1h C A 17: 25,377,667 R117L probably damaging Het
Cct6b A T 11: 82,741,349 V271E probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Cul1 G A 6: 47,523,788 R707H probably damaging Het
Dcakd A G 11: 102,995,005 L191P possibly damaging Het
Dhx32 T C 7: 133,721,228 *612W probably null Het
Disp1 T A 1: 183,088,349 T836S probably benign Het
Dppa4 T A 16: 48,291,030 V126D probably damaging Het
Fam98b A G 2: 117,267,786 T246A possibly damaging Het
Fkbp4 A T 6: 128,433,554 V273E probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr31b A G 17: 13,051,944 Y113H probably damaging Het
Gpr33 T C 12: 52,023,594 I221V probably damaging Het
Klhl1 A G 14: 96,518,293 F9L probably benign Het
Larp4b T A 13: 9,158,659 N449K probably damaging Het
Loxhd1 T C 18: 77,404,951 S1363P probably damaging Het
Lrrc8a T C 2: 30,255,354 V60A probably benign Het
Matn3 A G 12: 8,948,195 H51R probably benign Het
Mtrf1 T C 14: 79,401,445 C6R possibly damaging Het
Myh6 T C 14: 54,956,581 S784G probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Pcdhb20 A G 18: 37,504,532 E37G probably damaging Het
Pelp1 G A 11: 70,394,862 P727S possibly damaging Het
Prkca T C 11: 107,978,343 D472G possibly damaging Het
Ptprg A G 14: 12,122,120 H328R probably benign Het
Rtl1 C T 12: 109,592,739 E889K unknown Het
Rubcn T C 16: 32,826,923 D715G possibly damaging Het
Snurf C T 7: 59,999,385 E15K possibly damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Srp72 T G 5: 76,987,934 L237R probably damaging Het
Syne3 T C 12: 104,955,678 E406G probably damaging Het
Tgm2 A G 2: 158,128,720 S340P probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Tsc22d1 T C 14: 76,416,217 probably benign Het
Tsc22d2 G T 3: 58,417,162 probably benign Het
Vmn1r42 T C 6: 89,845,102 I162V possibly damaging Het
Vmn2r59 A G 7: 42,058,767 probably null Het
Wnt3 T C 11: 103,812,770 probably null Het
Other mutations in Nipal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Nipal3 APN 4 135468593 missense possibly damaging 0.90
IGL01338:Nipal3 APN 4 135471883 critical splice donor site probably null
IGL02149:Nipal3 APN 4 135466852 missense possibly damaging 0.67
IGL02160:Nipal3 APN 4 135474417 nonsense probably null
IGL02560:Nipal3 APN 4 135479704 missense probably damaging 1.00
IGL02826:Nipal3 APN 4 135468550 nonsense probably null
IGL02868:Nipal3 APN 4 135466871 missense probably damaging 1.00
R0189:Nipal3 UTSW 4 135468518 missense possibly damaging 0.89
R0470:Nipal3 UTSW 4 135447372 missense probably damaging 0.99
R0891:Nipal3 UTSW 4 135468587 missense possibly damaging 0.91
R1633:Nipal3 UTSW 4 135447348 missense probably benign 0.03
R1686:Nipal3 UTSW 4 135447288 missense possibly damaging 0.49
R2921:Nipal3 UTSW 4 135477465 missense probably damaging 1.00
R2923:Nipal3 UTSW 4 135477465 missense probably damaging 1.00
R3732:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3732:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3733:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3734:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R5057:Nipal3 UTSW 4 135466856 missense probably damaging 1.00
R5758:Nipal3 UTSW 4 135452563 missense probably benign 0.02
R5779:Nipal3 UTSW 4 135452339 intron probably benign
R5885:Nipal3 UTSW 4 135471977 missense probably damaging 0.97
R6572:Nipal3 UTSW 4 135447253 missense probably benign 0.02
R6981:Nipal3 UTSW 4 135479547 missense probably damaging 1.00
R7194:Nipal3 UTSW 4 135474421 missense probably benign 0.26
R7537:Nipal3 UTSW 4 135490937 missense probably damaging 1.00
R8018:Nipal3 UTSW 4 135447348 missense possibly damaging 0.63
R8098:Nipal3 UTSW 4 135452398 missense possibly damaging 0.87
R8503:Nipal3 UTSW 4 135479581 missense probably damaging 1.00
X0066:Nipal3 UTSW 4 135447255 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGCCAAGGTCATCGAATGGC -3'
(R):5'- CACTCAATGACTGGGCACATGG -3'

Sequencing Primer
(F):5'- AAGGTCATCGAATGGCTTCTC -3'
(R):5'- CACATGGATGTCATTTCAGGTATGC -3'
Posted On2016-11-08