Incidental Mutation 'R5616:Fkbp4'
ID439532
Institutional Source Beutler Lab
Gene Symbol Fkbp4
Ensembl Gene ENSMUSG00000030357
Gene NameFK506 binding protein 4
SynonymsFKBP52, FKBP-52
MMRRC Submission 043159-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R5616 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location128429735-128438677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128433554 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 273 (V273E)
Ref Sequence ENSEMBL: ENSMUSP00000032508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032508] [ENSMUST00000150387] [ENSMUST00000151796]
Predicted Effect probably damaging
Transcript: ENSMUST00000032508
AA Change: V273E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032508
Gene: ENSMUSG00000030357
AA Change: V273E

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 2.6e-33 PFAM
Pfam:FKBP_C 160 250 1.3e-14 PFAM
TPR 270 303 4.44e1 SMART
TPR 319 352 1.76e-5 SMART
TPR 353 386 2e-4 SMART
low complexity region 419 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139448
SMART Domains Protein: ENSMUSP00000114939
Gene: ENSMUSG00000030357

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 3.8e-33 PFAM
Pfam:FKBP_C 160 250 2.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150387
AA Change: V226E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119930
Gene: ENSMUSG00000030357
AA Change: V226E

DomainStartEndE-ValueType
Pfam:FKBP_C 1 88 7.8e-31 PFAM
Pfam:FKBP_C 113 203 4.7e-13 PFAM
Blast:TPR 223 256 3e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151796
SMART Domains Protein: ENSMUSP00000122087
Gene: ENSMUSG00000030357

DomainStartEndE-ValueType
Pfam:FKBP_C 1 88 3.7e-31 PFAM
Pfam:FKBP_C 113 187 3.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It has high structural and functional similarity to FK506-binding protein 1A (FKBP1A), but unlike FKBP1A, this protein does not have immunosuppressant activity when complexed with FK506. It interacts with interferon regulatory factor-4 and plays an important role in immunoregulatory gene expression in B and T lymphocytes. This encoded protein is known to associate with phytanoyl-CoA alpha-hydroxylase. It can also associate with two heat shock proteins (hsp90 and hsp70) and thus may play a role in the intracellular trafficking of hetero-oligomeric forms of the steroid hormone receptors. This protein correlates strongly with adeno-associated virus type 2 vectors (AAV) resulting in a significant increase in AAV-mediated transgene expression in human cell lines. Thus this encoded protein is thought to have important implications for the optimal use of AAV vectors in human gene therapy. The human genome contains several non-transcribed pseudogenes similar to this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygous null males show reproductive tissue defects consistent with androgen insensitivity such as ambiguous external genitalia, dysgenic prostate, malformed seminal gland and cryptorchism. Males also exhibit hypospadia and infertility. Females are sterile due to failure of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,772,360 D443E probably benign Het
Arhgef5 A G 6: 43,275,940 D1037G probably benign Het
B3glct T A 5: 149,729,934 L148* probably null Het
Cacna1e G A 1: 154,442,194 P1481S probably damaging Het
Cacna1h C A 17: 25,377,667 R117L probably damaging Het
Cct6b A T 11: 82,741,349 V271E probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Cul1 G A 6: 47,523,788 R707H probably damaging Het
Dcakd A G 11: 102,995,005 L191P possibly damaging Het
Dhx32 T C 7: 133,721,228 *612W probably null Het
Disp1 T A 1: 183,088,349 T836S probably benign Het
Dppa4 T A 16: 48,291,030 V126D probably damaging Het
Fam98b A G 2: 117,267,786 T246A possibly damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr31b A G 17: 13,051,944 Y113H probably damaging Het
Gpr33 T C 12: 52,023,594 I221V probably damaging Het
Klhl1 A G 14: 96,518,293 F9L probably benign Het
Larp4b T A 13: 9,158,659 N449K probably damaging Het
Loxhd1 T C 18: 77,404,951 S1363P probably damaging Het
Lrrc8a T C 2: 30,255,354 V60A probably benign Het
Matn3 A G 12: 8,948,195 H51R probably benign Het
Mtrf1 T C 14: 79,401,445 C6R possibly damaging Het
Myh6 T C 14: 54,956,581 S784G probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nipal3 T C 4: 135,452,404 Y401C probably benign Het
Pcdhb20 A G 18: 37,504,532 E37G probably damaging Het
Pelp1 G A 11: 70,394,862 P727S possibly damaging Het
Prkca T C 11: 107,978,343 D472G possibly damaging Het
Ptprg A G 14: 12,122,120 H328R probably benign Het
Rtl1 C T 12: 109,592,739 E889K unknown Het
Rubcn T C 16: 32,826,923 D715G possibly damaging Het
Snurf C T 7: 59,999,385 E15K possibly damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Srp72 T G 5: 76,987,934 L237R probably damaging Het
Syne3 T C 12: 104,955,678 E406G probably damaging Het
Tgm2 A G 2: 158,128,720 S340P probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Tsc22d1 T C 14: 76,416,217 probably benign Het
Tsc22d2 G T 3: 58,417,162 probably benign Het
Vmn1r42 T C 6: 89,845,102 I162V possibly damaging Het
Vmn2r59 A G 7: 42,058,767 probably null Het
Wnt3 T C 11: 103,812,770 probably null Het
Other mutations in Fkbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Fkbp4 APN 6 128435791 missense probably benign 0.28
IGL02215:Fkbp4 APN 6 128434470 splice site probably benign
IGL02607:Fkbp4 APN 6 128434470 splice site probably benign
IGL03186:Fkbp4 APN 6 128434800 missense probably benign
IGL03238:Fkbp4 APN 6 128434757 missense probably damaging 1.00
R0083:Fkbp4 UTSW 6 128432407 unclassified probably benign
R0491:Fkbp4 UTSW 6 128435742 missense probably damaging 1.00
R1652:Fkbp4 UTSW 6 128436674 missense probably damaging 0.97
R1868:Fkbp4 UTSW 6 128432490 missense probably benign 0.00
R2010:Fkbp4 UTSW 6 128435802 missense probably benign 0.01
R2292:Fkbp4 UTSW 6 128436662 missense probably damaging 1.00
R6478:Fkbp4 UTSW 6 128433231 missense probably damaging 1.00
R7156:Fkbp4 UTSW 6 128435824 missense probably benign 0.31
Z1177:Fkbp4 UTSW 6 128433111 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCTGGTAGGCACGAGTGAC -3'
(R):5'- CGCTGAGCTGAGGTATGAAG -3'

Sequencing Primer
(F):5'- AGTGACTCCTGGATAGAGCCTC -3'
(R):5'- AAGTGCGGCTGAAGAGCTTTG -3'
Posted On2016-11-08