Incidental Mutation 'R5616:Wnt3'
ID439541
Institutional Source Beutler Lab
Gene Symbol Wnt3
Ensembl Gene ENSMUSG00000000125
Gene Namewingless-type MMTV integration site family, member 3
SynonymsInt-4, Wnt-3
MMRRC Submission 043159-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5616 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location103774150-103817957 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 103812770 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000127]
Predicted Effect probably null
Transcript: ENSMUST00000000127
SMART Domains Protein: ENSMUSP00000000127
Gene: ENSMUSG00000000125

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
WNT1 47 355 1.24e-216 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 98% amino acid identity to mouse Wnt3 protein, and 84% to human WNT3A protein, another WNT gene product. The mouse studies show the requirement of Wnt3 in primary axis formation in the mouse. Studies of the gene expression suggest that this gene may play a key role in some cases of human breast, rectal, lung, and gastric cancer through activation of the WNT-beta-catenin-TCF signaling pathway. This gene is clustered with WNT15, another family member, in the chromosome 17q21 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants develop to the egg cylinder stage, but fail to form a primitive streak, mesoderm, or node, and die by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,772,360 D443E probably benign Het
Arhgef5 A G 6: 43,275,940 D1037G probably benign Het
B3glct T A 5: 149,729,934 L148* probably null Het
Cacna1e G A 1: 154,442,194 P1481S probably damaging Het
Cacna1h C A 17: 25,377,667 R117L probably damaging Het
Cct6b A T 11: 82,741,349 V271E probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Cul1 G A 6: 47,523,788 R707H probably damaging Het
Dcakd A G 11: 102,995,005 L191P possibly damaging Het
Dhx32 T C 7: 133,721,228 *612W probably null Het
Disp1 T A 1: 183,088,349 T836S probably benign Het
Dppa4 T A 16: 48,291,030 V126D probably damaging Het
Fam98b A G 2: 117,267,786 T246A possibly damaging Het
Fkbp4 A T 6: 128,433,554 V273E probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr31b A G 17: 13,051,944 Y113H probably damaging Het
Gpr33 T C 12: 52,023,594 I221V probably damaging Het
Klhl1 A G 14: 96,518,293 F9L probably benign Het
Larp4b T A 13: 9,158,659 N449K probably damaging Het
Loxhd1 T C 18: 77,404,951 S1363P probably damaging Het
Lrrc8a T C 2: 30,255,354 V60A probably benign Het
Matn3 A G 12: 8,948,195 H51R probably benign Het
Mtrf1 T C 14: 79,401,445 C6R possibly damaging Het
Myh6 T C 14: 54,956,581 S784G probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nipal3 T C 4: 135,452,404 Y401C probably benign Het
Pcdhb20 A G 18: 37,504,532 E37G probably damaging Het
Pelp1 G A 11: 70,394,862 P727S possibly damaging Het
Prkca T C 11: 107,978,343 D472G possibly damaging Het
Ptprg A G 14: 12,122,120 H328R probably benign Het
Rtl1 C T 12: 109,592,739 E889K unknown Het
Rubcn T C 16: 32,826,923 D715G possibly damaging Het
Snurf C T 7: 59,999,385 E15K possibly damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Srp72 T G 5: 76,987,934 L237R probably damaging Het
Syne3 T C 12: 104,955,678 E406G probably damaging Het
Tgm2 A G 2: 158,128,720 S340P probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Tsc22d1 T C 14: 76,416,217 probably benign Het
Tsc22d2 G T 3: 58,417,162 probably benign Het
Vmn1r42 T C 6: 89,845,102 I162V possibly damaging Het
Vmn2r59 A G 7: 42,058,767 probably null Het
Other mutations in Wnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Wnt3 APN 11 103808314 missense possibly damaging 0.81
IGL01645:Wnt3 APN 11 103812378 missense probably benign 0.00
IGL01989:Wnt3 APN 11 103812407 missense probably benign 0.44
IGL02087:Wnt3 APN 11 103812359 missense probably benign 0.34
IGL02525:Wnt3 APN 11 103812470 missense probably damaging 1.00
R0494:Wnt3 UTSW 11 103812315 missense probably damaging 1.00
R0615:Wnt3 UTSW 11 103812381 missense possibly damaging 0.68
R1438:Wnt3 UTSW 11 103808251 missense probably damaging 1.00
R2058:Wnt3 UTSW 11 103812285 missense probably damaging 0.97
R2127:Wnt3 UTSW 11 103812648 missense possibly damaging 0.82
R2128:Wnt3 UTSW 11 103812648 missense possibly damaging 0.82
R4470:Wnt3 UTSW 11 103812624 missense probably damaging 0.99
R4878:Wnt3 UTSW 11 103808205 missense possibly damaging 0.88
R6052:Wnt3 UTSW 11 103808174 nonsense probably null
R6472:Wnt3 UTSW 11 103808274 missense possibly damaging 0.89
R6687:Wnt3 UTSW 11 103812585 missense probably damaging 1.00
R7652:Wnt3 UTSW 11 103812464 missense possibly damaging 0.83
R7760:Wnt3 UTSW 11 103811440 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTTTGTGAGCCCAACCCAG -3'
(R):5'- CGTGTAAATACGTCAAGTCGC -3'

Sequencing Primer
(F):5'- GACCGGACTTGCAATGTCAC -3'
(R):5'- TGTAAATACGTCAAGTCGCTCCCC -3'
Posted On2016-11-08