Incidental Mutation 'R5616:Matn3'
ID439542
Institutional Source Beutler Lab
Gene Symbol Matn3
Ensembl Gene ENSMUSG00000020583
Gene Namematrilin 3
Synonyms
MMRRC Submission 043159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5616 (G1)
Quality Score202
Status Not validated
Chromosome12
Chromosomal Location8947929-8972028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8948195 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 51 (H51R)
Ref Sequence ENSEMBL: ENSMUSP00000020899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020899]
Predicted Effect probably benign
Transcript: ENSMUST00000020899
AA Change: H51R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020899
Gene: ENSMUSG00000020583
AA Change: H51R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWA 76 255 5.06e-51 SMART
EGF 257 300 2.02e-1 SMART
EGF 304 342 4.1e-2 SMART
EGF 346 384 4.22e-4 SMART
EGF 388 426 1.21e-4 SMART
Matrilin_ccoil 433 479 8.93e-14 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,772,360 D443E probably benign Het
Arhgef5 A G 6: 43,275,940 D1037G probably benign Het
B3glct T A 5: 149,729,934 L148* probably null Het
Cacna1e G A 1: 154,442,194 P1481S probably damaging Het
Cacna1h C A 17: 25,377,667 R117L probably damaging Het
Cct6b A T 11: 82,741,349 V271E probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Cul1 G A 6: 47,523,788 R707H probably damaging Het
Dcakd A G 11: 102,995,005 L191P possibly damaging Het
Dhx32 T C 7: 133,721,228 *612W probably null Het
Disp1 T A 1: 183,088,349 T836S probably benign Het
Dppa4 T A 16: 48,291,030 V126D probably damaging Het
Fam98b A G 2: 117,267,786 T246A possibly damaging Het
Fkbp4 A T 6: 128,433,554 V273E probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr31b A G 17: 13,051,944 Y113H probably damaging Het
Gpr33 T C 12: 52,023,594 I221V probably damaging Het
Klhl1 A G 14: 96,518,293 F9L probably benign Het
Larp4b T A 13: 9,158,659 N449K probably damaging Het
Loxhd1 T C 18: 77,404,951 S1363P probably damaging Het
Lrrc8a T C 2: 30,255,354 V60A probably benign Het
Mtrf1 T C 14: 79,401,445 C6R possibly damaging Het
Myh6 T C 14: 54,956,581 S784G probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nipal3 T C 4: 135,452,404 Y401C probably benign Het
Pcdhb20 A G 18: 37,504,532 E37G probably damaging Het
Pelp1 G A 11: 70,394,862 P727S possibly damaging Het
Prkca T C 11: 107,978,343 D472G possibly damaging Het
Ptprg A G 14: 12,122,120 H328R probably benign Het
Rtl1 C T 12: 109,592,739 E889K unknown Het
Rubcn T C 16: 32,826,923 D715G possibly damaging Het
Snurf C T 7: 59,999,385 E15K possibly damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Srp72 T G 5: 76,987,934 L237R probably damaging Het
Syne3 T C 12: 104,955,678 E406G probably damaging Het
Tgm2 A G 2: 158,128,720 S340P probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Tsc22d1 T C 14: 76,416,217 probably benign Het
Tsc22d2 G T 3: 58,417,162 probably benign Het
Vmn1r42 T C 6: 89,845,102 I162V possibly damaging Het
Vmn2r59 A G 7: 42,058,767 probably null Het
Wnt3 T C 11: 103,812,770 probably null Het
Other mutations in Matn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Matn3 APN 12 8952091 missense probably damaging 0.98
IGL02138:Matn3 APN 12 8967638 missense possibly damaging 0.93
IGL02442:Matn3 APN 12 8967678 nonsense probably null
IGL02736:Matn3 APN 12 8955422 missense possibly damaging 0.53
R0091:Matn3 UTSW 12 8952105 missense probably damaging 0.98
R0585:Matn3 UTSW 12 8961103 splice site probably benign
R0615:Matn3 UTSW 12 8963594 missense probably damaging 1.00
R1424:Matn3 UTSW 12 8961132 missense possibly damaging 0.91
R1571:Matn3 UTSW 12 8955466 missense probably damaging 1.00
R1844:Matn3 UTSW 12 8967662 missense possibly damaging 0.90
R1865:Matn3 UTSW 12 8952041 missense probably damaging 1.00
R1977:Matn3 UTSW 12 8961110 splice site probably benign
R3015:Matn3 UTSW 12 8952217 missense probably damaging 0.97
R3018:Matn3 UTSW 12 8963578 missense probably benign 0.02
R5180:Matn3 UTSW 12 8955374 missense probably benign 0.38
R5308:Matn3 UTSW 12 8952308 frame shift probably null
R5816:Matn3 UTSW 12 8970571 missense probably damaging 1.00
R5849:Matn3 UTSW 12 8958829 missense probably benign 0.10
R7065:Matn3 UTSW 12 8952472 missense probably damaging 0.99
R7206:Matn3 UTSW 12 8961170 missense probably benign 0.01
RF001:Matn3 UTSW 12 8958797 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGGACCTTTAAATTGGTTGCC -3'
(R):5'- GGCACGTAGATGTAGCATGC -3'

Sequencing Primer
(F):5'- TATGGCTGAGACCTCTGACC -3'
(R):5'- CACGTAGATGTAGCATGCTACGTTC -3'
Posted On2016-11-08