Incidental Mutation 'R5617:Asb18'
ID439558
Institutional Source Beutler Lab
Gene Symbol Asb18
Ensembl Gene ENSMUSG00000067081
Gene Nameankyrin repeat and SOCS box-containing 18
Synonyms
MMRRC Submission 043276-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5617 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location89950220-90014666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89954462 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 118 (V118A)
Ref Sequence ENSEMBL: ENSMUSP00000095261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086882] [ENSMUST00000097656] [ENSMUST00000151330] [ENSMUST00000154228]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086882
AA Change: V382A

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084095
Gene: ENSMUSG00000067081
AA Change: V382A

DomainStartEndE-ValueType
Blast:ANK 15 44 3e-8 BLAST
ANK 119 148 5.32e-5 SMART
ANK 151 180 1.99e-4 SMART
ANK 184 213 3.26e2 SMART
ANK 218 247 3.95e1 SMART
ANK 251 289 1.96e3 SMART
ANK 293 322 6.61e-1 SMART
Blast:ANK 329 365 1e-12 BLAST
SOCS_box 422 461 4.5e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097656
AA Change: V118A

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095261
Gene: ENSMUSG00000067081
AA Change: V118A

DomainStartEndE-ValueType
Blast:ANK 15 44 1e-8 BLAST
SOCS_box 158 197 4.5e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151330
SMART Domains Protein: ENSMUSP00000117836
Gene: ENSMUSG00000067081

DomainStartEndE-ValueType
Blast:ANK 15 44 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154228
SMART Domains Protein: ENSMUSP00000117767
Gene: ENSMUSG00000067081

DomainStartEndE-ValueType
Blast:ANK 15 44 9e-9 BLAST
ANK 78 107 5.32e-5 SMART
ANK 110 139 1.99e-4 SMART
Meta Mutation Damage Score 0.1035 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,277,891 L645F probably benign Het
Acss3 T C 10: 106,951,990 Y522C probably damaging Het
Aste1 T A 9: 105,397,835 C8S probably benign Het
Atp10a A G 7: 58,803,675 S834G probably benign Het
Cdh18 A G 15: 23,226,768 D105G probably damaging Het
Cenpb T C 2: 131,179,014 E288G probably damaging Het
Clcnka C T 4: 141,389,317 G541D probably null Het
Dctn3 T C 4: 41,716,407 I134V possibly damaging Het
Dennd4b T C 3: 90,275,626 S917P probably benign Het
Fam135b A T 15: 71,622,016 D21E probably damaging Het
Fam174a T C 1: 95,314,247 V144A probably damaging Het
Fbxo38 A G 18: 62,505,971 Y1087H probably damaging Het
Gm7275 A T 16: 48,074,164 noncoding transcript Het
Gm9271 G T 7: 39,363,652 noncoding transcript Het
Grm2 T C 9: 106,651,076 probably null Het
Hrasls A T 16: 29,220,410 R81* probably null Het
Htt T A 5: 34,870,806 V1802D possibly damaging Het
Ighv1-75 C A 12: 115,834,254 G16V probably benign Het
Krt78 G A 15: 101,947,609 T589I probably damaging Het
Lama3 T C 18: 12,498,936 probably benign Het
Lbr A T 1: 181,828,902 V227D probably benign Het
Lsamp T C 16: 42,134,423 V211A probably damaging Het
Map3k19 G A 1: 127,822,966 R883C probably damaging Het
March8 A C 6: 116,403,520 I111L possibly damaging Het
Mrps10 T A 17: 47,378,242 M187K probably benign Het
Ncdn G A 4: 126,745,047 R660C probably damaging Het
Notum A T 11: 120,656,345 Y332* probably null Het
Nr1h5 A T 3: 102,947,829 L319I probably damaging Het
Olfr1082 T A 2: 86,594,001 I276L probably benign Het
Olfr635 A T 7: 103,979,714 H180L possibly damaging Het
Osbpl5 T C 7: 143,692,947 D765G possibly damaging Het
Parp3 C T 9: 106,474,505 V170M possibly damaging Het
Pcdh15 A G 10: 74,635,672 probably benign Het
Pcdha9 T G 18: 36,998,816 S313A probably benign Het
Pfkm A G 15: 98,122,226 R201G possibly damaging Het
Pgm5 G A 19: 24,750,401 R375* probably null Het
Phactr2 A G 10: 13,474,065 S72P possibly damaging Het
Plec A G 15: 76,174,532 L3600P probably damaging Het
Pou6f1 G A 15: 100,585,993 T208M possibly damaging Het
Rabep1 C T 11: 70,917,529 S394L probably damaging Het
Ranbp2 T G 10: 58,465,667 F687C probably damaging Het
Ranbp6 A G 19: 29,812,463 F163S probably damaging Het
Rcor3 T C 1: 192,120,130 N240D probably benign Het
Samd13 C A 3: 146,646,310 K95N probably benign Het
Slc25a17 G T 15: 81,360,774 probably benign Het
Slfn8 G T 11: 83,004,721 H420N probably benign Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Stim2 G A 5: 54,109,733 E21K probably damaging Het
Tmem163 A G 1: 127,551,330 Y151H possibly damaging Het
Trio A G 15: 27,902,748 I209T probably benign Het
Tubal3 T A 13: 3,933,432 L404H probably damaging Het
Ubqln3 A G 7: 104,142,433 F150S probably damaging Het
Ubr5 T C 15: 38,030,657 S425G possibly damaging Het
Vmn2r52 T A 7: 10,170,934 H326L probably damaging Het
Other mutations in Asb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Asb18 APN 1 89996241 missense probably benign 0.02
IGL01559:Asb18 APN 1 89954450 missense probably damaging 1.00
IGL02188:Asb18 APN 1 89996299 missense probably benign 0.08
IGL02378:Asb18 APN 1 89992988 missense probably damaging 1.00
IGL02543:Asb18 APN 1 90014391 missense probably damaging 0.99
IGL02828:Asb18 APN 1 89996210 critical splice donor site probably null
IGL02877:Asb18 APN 1 89952811 missense possibly damaging 0.65
IGL03290:Asb18 APN 1 90014574 missense probably damaging 1.00
R0560:Asb18 UTSW 1 90014528 missense probably damaging 1.00
R0671:Asb18 UTSW 1 89993171 missense probably damaging 1.00
R1468:Asb18 UTSW 1 89996283 missense probably damaging 1.00
R1468:Asb18 UTSW 1 89996283 missense probably damaging 1.00
R1510:Asb18 UTSW 1 89996254 missense possibly damaging 0.62
R1721:Asb18 UTSW 1 89968580 missense probably benign 0.36
R1793:Asb18 UTSW 1 90014555 missense probably damaging 1.00
R1863:Asb18 UTSW 1 90014382 missense probably benign 0.10
R2171:Asb18 UTSW 1 89968697 missense probably benign 0.01
R2348:Asb18 UTSW 1 90014534 missense probably damaging 0.99
R3052:Asb18 UTSW 1 89992985 missense probably damaging 1.00
R3053:Asb18 UTSW 1 89992985 missense probably damaging 1.00
R3427:Asb18 UTSW 1 89968593 missense probably damaging 0.99
R4094:Asb18 UTSW 1 90014425 missense probably damaging 1.00
R4105:Asb18 UTSW 1 89968521 missense possibly damaging 0.61
R4405:Asb18 UTSW 1 89968689 missense probably benign 0.00
R4815:Asb18 UTSW 1 90014425 missense probably damaging 1.00
R4992:Asb18 UTSW 1 89952863 missense probably benign 0.03
R5287:Asb18 UTSW 1 90014388 missense probably benign 0.01
R5403:Asb18 UTSW 1 90014388 missense probably benign 0.01
R5494:Asb18 UTSW 1 89954399 missense probably damaging 1.00
R5504:Asb18 UTSW 1 89993024 missense probably damaging 1.00
R5826:Asb18 UTSW 1 90014538 missense probably damaging 0.97
R6369:Asb18 UTSW 1 90014471 missense probably damaging 0.99
R7474:Asb18 UTSW 1 89993033 missense possibly damaging 0.91
R7751:Asb18 UTSW 1 89968484 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTTCAGATGTTTTACTTCCTGGC -3'
(R):5'- TTGGGCCTTTGAGGTCAC -3'

Sequencing Primer
(F):5'- GTGTTTTGTCATAGCAACGGAACCC -3'
(R):5'- TTTGAGGTCACAGGGCCAG -3'
Posted On2016-11-08