Incidental Mutation 'R5617:Lbr'
ID439562
Institutional Source Beutler Lab
Gene Symbol Lbr
Ensembl Gene ENSMUSG00000004880
Gene Namelamin B receptor
Synonyms
MMRRC Submission 043276-MU
Accession Numbers

Genbank: NM_133815.2; Ensembl: ENSMUST00000005003

Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R5617 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location181815335-181843046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 181828902 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 227 (V227D)
Ref Sequence ENSEMBL: ENSMUSP00000005003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005003]
Predicted Effect probably benign
Transcript: ENSMUST00000005003
AA Change: V227D

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000005003
Gene: ENSMUSG00000004880
AA Change: V227D

DomainStartEndE-ValueType
TUDOR 4 62 6.7e-9 SMART
low complexity region 63 101 N/A INTRINSIC
low complexity region 111 121 N/A INTRINSIC
Pfam:ERG4_ERG24 194 626 4.6e-161 PFAM
Pfam:DUF1295 452 617 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194302
Predicted Effect probably benign
Transcript: ENSMUST00000194415
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ERG4/ERG24 family. It localized in the nuclear envelope inner membrane and anchors the lamina and the heterochromatin to the membrane. It may mediate interaction between chromatin and lamin B. Mutations of this gene has been associated with autosomal recessive HEM/Greenberg skeletal dysplasia. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in abnormal skin and hair and impair growth. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(17) Spontaneous(6)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,277,891 L645F probably benign Het
Acss3 T C 10: 106,951,990 Y522C probably damaging Het
Asb18 A G 1: 89,954,462 V118A possibly damaging Het
Aste1 T A 9: 105,397,835 C8S probably benign Het
Atp10a A G 7: 58,803,675 S834G probably benign Het
Cdh18 A G 15: 23,226,768 D105G probably damaging Het
Cenpb T C 2: 131,179,014 E288G probably damaging Het
Clcnka C T 4: 141,389,317 G541D probably null Het
Dctn3 T C 4: 41,716,407 I134V possibly damaging Het
Dennd4b T C 3: 90,275,626 S917P probably benign Het
Fam135b A T 15: 71,622,016 D21E probably damaging Het
Fam174a T C 1: 95,314,247 V144A probably damaging Het
Fbxo38 A G 18: 62,505,971 Y1087H probably damaging Het
Gm7275 A T 16: 48,074,164 noncoding transcript Het
Gm9271 G T 7: 39,363,652 noncoding transcript Het
Grm2 T C 9: 106,651,076 probably null Het
Hrasls A T 16: 29,220,410 R81* probably null Het
Htt T A 5: 34,870,806 V1802D possibly damaging Het
Ighv1-75 C A 12: 115,834,254 G16V probably benign Het
Krt78 G A 15: 101,947,609 T589I probably damaging Het
Lama3 T C 18: 12,498,936 probably benign Het
Lsamp T C 16: 42,134,423 V211A probably damaging Het
Map3k19 G A 1: 127,822,966 R883C probably damaging Het
March8 A C 6: 116,403,520 I111L possibly damaging Het
Mrps10 T A 17: 47,378,242 M187K probably benign Het
Ncdn G A 4: 126,745,047 R660C probably damaging Het
Notum A T 11: 120,656,345 Y332* probably null Het
Nr1h5 A T 3: 102,947,829 L319I probably damaging Het
Olfr1082 T A 2: 86,594,001 I276L probably benign Het
Olfr635 A T 7: 103,979,714 H180L possibly damaging Het
Osbpl5 T C 7: 143,692,947 D765G possibly damaging Het
Parp3 C T 9: 106,474,505 V170M possibly damaging Het
Pcdh15 A G 10: 74,635,672 probably benign Het
Pcdha9 T G 18: 36,998,816 S313A probably benign Het
Pfkm A G 15: 98,122,226 R201G possibly damaging Het
Pgm5 G A 19: 24,750,401 R375* probably null Het
Phactr2 A G 10: 13,474,065 S72P possibly damaging Het
Plec A G 15: 76,174,532 L3600P probably damaging Het
Pou6f1 G A 15: 100,585,993 T208M possibly damaging Het
Rabep1 C T 11: 70,917,529 S394L probably damaging Het
Ranbp2 T G 10: 58,465,667 F687C probably damaging Het
Ranbp6 A G 19: 29,812,463 F163S probably damaging Het
Rcor3 T C 1: 192,120,130 N240D probably benign Het
Samd13 C A 3: 146,646,310 K95N probably benign Het
Slc25a17 G T 15: 81,360,774 probably benign Het
Slfn8 G T 11: 83,004,721 H420N probably benign Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Stim2 G A 5: 54,109,733 E21K probably damaging Het
Tmem163 A G 1: 127,551,330 Y151H possibly damaging Het
Trio A G 15: 27,902,748 I209T probably benign Het
Tubal3 T A 13: 3,933,432 L404H probably damaging Het
Ubqln3 A G 7: 104,142,433 F150S probably damaging Het
Ubr5 T C 15: 38,030,657 S425G possibly damaging Het
Vmn2r52 T A 7: 10,170,934 H326L probably damaging Het
Other mutations in Lbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Lbr APN 1 181825643 nonsense probably null
IGL01680:Lbr APN 1 181836194 missense probably damaging 1.00
IGL02738:Lbr APN 1 181832213 missense probably benign 0.16
IGL03048:Lbr APN 1 181838544 utr 5 prime probably benign
IGL03227:Lbr APN 1 181836055 unclassified probably null
IGL03337:Lbr APN 1 181832223 missense possibly damaging 0.92
Aconcagua UTSW 1 181828902 missense probably benign 0.02
kosciuszko UTSW 1 181825621 critical splice donor site probably null
Mont_blanc UTSW 1 181820702 missense probably damaging 1.00
seven UTSW 1 181832213 missense probably benign 0.16
1mM(1):Lbr UTSW 1 181831679 missense possibly damaging 0.65
H8562:Lbr UTSW 1 181820668 splice site probably benign
IGL02991:Lbr UTSW 1 181821552 missense probably damaging 1.00
R0597:Lbr UTSW 1 181832213 missense probably benign 0.16
R1118:Lbr UTSW 1 181820668 splice site probably benign
R1727:Lbr UTSW 1 181819916 missense probably benign 0.01
R2566:Lbr UTSW 1 181836127 missense probably damaging 0.96
R3699:Lbr UTSW 1 181818920 missense probably damaging 1.00
R3854:Lbr UTSW 1 181831715 missense probably benign 0.05
R4290:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4292:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4293:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4294:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4295:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4771:Lbr UTSW 1 181838421 missense probably damaging 1.00
R4890:Lbr UTSW 1 181817568 missense probably benign 0.10
R5011:Lbr UTSW 1 181819888 nonsense probably null
R5402:Lbr UTSW 1 181819961 missense probably benign 0.00
R5486:Lbr UTSW 1 181818838 critical splice donor site probably null
R5630:Lbr UTSW 1 181816964 unclassified probably null
R6360:Lbr UTSW 1 181832155 missense probably benign 0.00
R6575:Lbr UTSW 1 181836198 missense probably damaging 1.00
R7069:Lbr UTSW 1 181828789 missense probably damaging 1.00
R7342:Lbr UTSW 1 181825621 critical splice donor site probably null
R7590:Lbr UTSW 1 181821511 missense probably damaging 1.00
R7686:Lbr UTSW 1 181817521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCCCAACTGGTAGAAGG -3'
(R):5'- ATTTTCCCAGCCAAGACAGG -3'

Sequencing Primer
(F):5'- CTGGTAGAAGGTGGAAGAGAGCTTG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2016-11-08