Incidental Mutation 'R5617:Cenpb'
ID439566
Institutional Source Beutler Lab
Gene Symbol Cenpb
Ensembl Gene ENSMUSG00000068267
Gene Namecentromere protein B
Synonyms
MMRRC Submission 043276-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R5617 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131175182-131180067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131179014 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 288 (E288G)
Ref Sequence ENSEMBL: ENSMUSP00000086938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028801] [ENSMUST00000089510] [ENSMUST00000110218]
Predicted Effect probably benign
Transcript: ENSMUST00000028801
SMART Domains Protein: ENSMUSP00000028801
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH_2 13 109 9.3e-36 PFAM
Pfam:CAMSAP_CH 14 96 7.9e-24 PFAM
coiled coil region 182 234 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089510
AA Change: E288G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086938
Gene: ENSMUSG00000068267
AA Change: E288G

DomainStartEndE-ValueType
Pfam:CENP-B_N 2 56 1.6e-26 PFAM
CENPB 71 136 7.05e-23 SMART
low complexity region 140 158 N/A INTRINSIC
Pfam:DDE_1 222 384 4.9e-44 PFAM
coiled coil region 402 439 N/A INTRINSIC
Pfam:CENP-B_dimeris 499 598 5.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110218
SMART Domains Protein: ENSMUSP00000105847
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH 10 103 1.2e-7 PFAM
Pfam:DUF1042 13 164 5.7e-58 PFAM
Pfam:CAMSAP_CH 14 96 9e-23 PFAM
coiled coil region 182 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127987
SMART Domains Protein: ENSMUSP00000114178
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH_2 7 103 1.7e-36 PFAM
Pfam:CAMSAP_CH 8 90 6e-24 PFAM
Meta Mutation Damage Score 0.1718 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a highly conserved protein that facilitates centromere formation. It is a DNA-binding protein that is derived from transposases of the pogo DNA transposon family. It contains a helix-loop-helix DNA binding motif at the N-terminus, and a dimerization domain at the C-terminus. The DNA binding domain recognizes and binds a 17-bp sequence (CENP-B box) in the centromeric alpha satellite DNA. This protein is proposed to play an important role in the assembly of specific centromere structures in interphase nuclei and on mitotic chromosomes. It is also considered a major centromere autoantigen recognized by sera from patients with anti-centromere antibodies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display decreased body weight, small testis, oligospermia, and an age- and background-dependent reduction in female reproductive competence associated with abnormalities in uterus morphology, metral environment, gestational length, and parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,277,891 L645F probably benign Het
Acss3 T C 10: 106,951,990 Y522C probably damaging Het
Asb18 A G 1: 89,954,462 V118A possibly damaging Het
Aste1 T A 9: 105,397,835 C8S probably benign Het
Atp10a A G 7: 58,803,675 S834G probably benign Het
Cdh18 A G 15: 23,226,768 D105G probably damaging Het
Clcnka C T 4: 141,389,317 G541D probably null Het
Dctn3 T C 4: 41,716,407 I134V possibly damaging Het
Dennd4b T C 3: 90,275,626 S917P probably benign Het
Fam135b A T 15: 71,622,016 D21E probably damaging Het
Fam174a T C 1: 95,314,247 V144A probably damaging Het
Fbxo38 A G 18: 62,505,971 Y1087H probably damaging Het
Gm7275 A T 16: 48,074,164 noncoding transcript Het
Gm9271 G T 7: 39,363,652 noncoding transcript Het
Grm2 T C 9: 106,651,076 probably null Het
Hrasls A T 16: 29,220,410 R81* probably null Het
Htt T A 5: 34,870,806 V1802D possibly damaging Het
Ighv1-75 C A 12: 115,834,254 G16V probably benign Het
Krt78 G A 15: 101,947,609 T589I probably damaging Het
Lama3 T C 18: 12,498,936 probably benign Het
Lbr A T 1: 181,828,902 V227D probably benign Het
Lsamp T C 16: 42,134,423 V211A probably damaging Het
Map3k19 G A 1: 127,822,966 R883C probably damaging Het
March8 A C 6: 116,403,520 I111L possibly damaging Het
Mrps10 T A 17: 47,378,242 M187K probably benign Het
Ncdn G A 4: 126,745,047 R660C probably damaging Het
Notum A T 11: 120,656,345 Y332* probably null Het
Nr1h5 A T 3: 102,947,829 L319I probably damaging Het
Olfr1082 T A 2: 86,594,001 I276L probably benign Het
Olfr635 A T 7: 103,979,714 H180L possibly damaging Het
Osbpl5 T C 7: 143,692,947 D765G possibly damaging Het
Parp3 C T 9: 106,474,505 V170M possibly damaging Het
Pcdh15 A G 10: 74,635,672 probably benign Het
Pcdha9 T G 18: 36,998,816 S313A probably benign Het
Pfkm A G 15: 98,122,226 R201G possibly damaging Het
Pgm5 G A 19: 24,750,401 R375* probably null Het
Phactr2 A G 10: 13,474,065 S72P possibly damaging Het
Plec A G 15: 76,174,532 L3600P probably damaging Het
Pou6f1 G A 15: 100,585,993 T208M possibly damaging Het
Rabep1 C T 11: 70,917,529 S394L probably damaging Het
Ranbp2 T G 10: 58,465,667 F687C probably damaging Het
Ranbp6 A G 19: 29,812,463 F163S probably damaging Het
Rcor3 T C 1: 192,120,130 N240D probably benign Het
Samd13 C A 3: 146,646,310 K95N probably benign Het
Slc25a17 G T 15: 81,360,774 probably benign Het
Slfn8 G T 11: 83,004,721 H420N probably benign Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Stim2 G A 5: 54,109,733 E21K probably damaging Het
Tmem163 A G 1: 127,551,330 Y151H possibly damaging Het
Trio A G 15: 27,902,748 I209T probably benign Het
Tubal3 T A 13: 3,933,432 L404H probably damaging Het
Ubqln3 A G 7: 104,142,433 F150S probably damaging Het
Ubr5 T C 15: 38,030,657 S425G possibly damaging Het
Vmn2r52 T A 7: 10,170,934 H326L probably damaging Het
Other mutations in Cenpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02421:Cenpb APN 2 131179681 missense probably damaging 1.00
R0183:Cenpb UTSW 2 131178453 unclassified probably benign
R1378:Cenpb UTSW 2 131178310 unclassified probably benign
R1934:Cenpb UTSW 2 131179264 missense probably benign
R2086:Cenpb UTSW 2 131178597 unclassified probably benign
R2132:Cenpb UTSW 2 131179306 missense probably damaging 1.00
R4776:Cenpb UTSW 2 131178183 unclassified probably benign
R5056:Cenpb UTSW 2 131178171 unclassified probably benign
R5120:Cenpb UTSW 2 131179818 missense probably benign 0.00
R6297:Cenpb UTSW 2 131178369 unclassified probably benign
R6467:Cenpb UTSW 2 131179557 missense probably damaging 1.00
R6673:Cenpb UTSW 2 131179245 missense probably damaging 0.98
R6916:Cenpb UTSW 2 131179624 missense probably benign 0.04
R7102:Cenpb UTSW 2 131178879 missense probably damaging 0.99
R7888:Cenpb UTSW 2 131179842 missense probably damaging 0.99
R7971:Cenpb UTSW 2 131179842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCCTTGAGCAACATCGC -3'
(R):5'- AGCCTGTGGTACGACTTTCTG -3'

Sequencing Primer
(F):5'- TTGAGCAACATCGCCTGGC -3'
(R):5'- ACTTTCTGTCGGACCAGGC -3'
Posted On2016-11-08