Incidental Mutation 'R5617:Nr1h5'
ID439569
Institutional Source Beutler Lab
Gene Symbol Nr1h5
Ensembl Gene ENSMUSG00000048938
Gene Namenuclear receptor subfamily 1, group H, member 5
SynonymsFXRB
MMRRC Submission 043276-MU
Accession Numbers

Ncbi RefSeq: NM_198658.2, NM_201619.2, NM_201622.2

Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R5617 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location102939658-102964133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102947829 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 319 (L319I)
Ref Sequence ENSEMBL: ENSMUSP00000142345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058899] [ENSMUST00000196135] [ENSMUST00000196983] [ENSMUST00000197412] [ENSMUST00000198472]
Predicted Effect probably damaging
Transcript: ENSMUST00000058899
AA Change: L319I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052557
Gene: ENSMUSG00000048938
AA Change: L319I

DomainStartEndE-ValueType
Blast:HOLI 2 47 5e-9 BLAST
ZnF_C4 119 190 2.51e-36 SMART
HOLI 289 474 1.74e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083774
Predicted Effect probably damaging
Transcript: ENSMUST00000196135
AA Change: L261I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143445
Gene: ENSMUSG00000048938
AA Change: L261I

DomainStartEndE-ValueType
ZnF_C4 78 132 1.17e-7 SMART
HOLI 231 416 1.74e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196983
AA Change: L319I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142799
Gene: ENSMUSG00000048938
AA Change: L319I

DomainStartEndE-ValueType
Blast:HOLI 2 47 5e-9 BLAST
ZnF_C4 119 190 2.51e-36 SMART
HOLI 289 466 1.76e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197412
AA Change: L319I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143764
Gene: ENSMUSG00000048938
AA Change: L319I

DomainStartEndE-ValueType
Blast:HOLI 2 47 4e-9 BLAST
ZnF_C4 119 190 1e-38 SMART
Pfam:Hormone_recep 274 362 6e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198472
AA Change: L319I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142345
Gene: ENSMUSG00000048938
AA Change: L319I

DomainStartEndE-ValueType
Blast:HOLI 2 47 4e-9 BLAST
ZnF_C4 119 190 1e-38 SMART
Pfam:Hormone_recep 273 367 5.8e-6 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (59/59)
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,277,891 L645F probably benign Het
Acss3 T C 10: 106,951,990 Y522C probably damaging Het
Asb18 A G 1: 89,954,462 V118A possibly damaging Het
Aste1 T A 9: 105,397,835 C8S probably benign Het
Atp10a A G 7: 58,803,675 S834G probably benign Het
Cdh18 A G 15: 23,226,768 D105G probably damaging Het
Cenpb T C 2: 131,179,014 E288G probably damaging Het
Clcnka C T 4: 141,389,317 G541D probably null Het
Dctn3 T C 4: 41,716,407 I134V possibly damaging Het
Dennd4b T C 3: 90,275,626 S917P probably benign Het
Fam135b A T 15: 71,622,016 D21E probably damaging Het
Fam174a T C 1: 95,314,247 V144A probably damaging Het
Fbxo38 A G 18: 62,505,971 Y1087H probably damaging Het
Gm7275 A T 16: 48,074,164 noncoding transcript Het
Gm9271 G T 7: 39,363,652 noncoding transcript Het
Grm2 T C 9: 106,651,076 probably null Het
Hrasls A T 16: 29,220,410 R81* probably null Het
Htt T A 5: 34,870,806 V1802D possibly damaging Het
Ighv1-75 C A 12: 115,834,254 G16V probably benign Het
Krt78 G A 15: 101,947,609 T589I probably damaging Het
Lama3 T C 18: 12,498,936 probably benign Het
Lbr A T 1: 181,828,902 V227D probably benign Het
Lsamp T C 16: 42,134,423 V211A probably damaging Het
Map3k19 G A 1: 127,822,966 R883C probably damaging Het
March8 A C 6: 116,403,520 I111L possibly damaging Het
Mrps10 T A 17: 47,378,242 M187K probably benign Het
Ncdn G A 4: 126,745,047 R660C probably damaging Het
Notum A T 11: 120,656,345 Y332* probably null Het
Olfr1082 T A 2: 86,594,001 I276L probably benign Het
Olfr635 A T 7: 103,979,714 H180L possibly damaging Het
Osbpl5 T C 7: 143,692,947 D765G possibly damaging Het
Parp3 C T 9: 106,474,505 V170M possibly damaging Het
Pcdh15 A G 10: 74,635,672 probably benign Het
Pcdha9 T G 18: 36,998,816 S313A probably benign Het
Pfkm A G 15: 98,122,226 R201G possibly damaging Het
Pgm5 G A 19: 24,750,401 R375* probably null Het
Phactr2 A G 10: 13,474,065 S72P possibly damaging Het
Plec A G 15: 76,174,532 L3600P probably damaging Het
Pou6f1 G A 15: 100,585,993 T208M possibly damaging Het
Rabep1 C T 11: 70,917,529 S394L probably damaging Het
Ranbp2 T G 10: 58,465,667 F687C probably damaging Het
Ranbp6 A G 19: 29,812,463 F163S probably damaging Het
Rcor3 T C 1: 192,120,130 N240D probably benign Het
Samd13 C A 3: 146,646,310 K95N probably benign Het
Slc25a17 G T 15: 81,360,774 probably benign Het
Slfn8 G T 11: 83,004,721 H420N probably benign Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Stim2 G A 5: 54,109,733 E21K probably damaging Het
Tmem163 A G 1: 127,551,330 Y151H possibly damaging Het
Trio A G 15: 27,902,748 I209T probably benign Het
Tubal3 T A 13: 3,933,432 L404H probably damaging Het
Ubqln3 A G 7: 104,142,433 F150S probably damaging Het
Ubr5 T C 15: 38,030,657 S425G possibly damaging Het
Vmn2r52 T A 7: 10,170,934 H326L probably damaging Het
Other mutations in Nr1h5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01829:Nr1h5 APN 3 102949079 missense probably benign 0.02
IGL02021:Nr1h5 APN 3 102947742 intron probably benign
IGL02025:Nr1h5 APN 3 102949626 splice site probably benign
IGL02094:Nr1h5 APN 3 102952196 nonsense probably null
R0035:Nr1h5 UTSW 3 102949573 nonsense probably null
R0035:Nr1h5 UTSW 3 102949573 nonsense probably null
R1200:Nr1h5 UTSW 3 102947862 missense probably damaging 1.00
R1977:Nr1h5 UTSW 3 102947817 missense probably damaging 1.00
R4173:Nr1h5 UTSW 3 102952230 missense probably damaging 1.00
R4556:Nr1h5 UTSW 3 102946141 missense probably benign 0.28
R5018:Nr1h5 UTSW 3 102947795 missense probably damaging 1.00
R5471:Nr1h5 UTSW 3 102949126 missense possibly damaging 0.74
R5822:Nr1h5 UTSW 3 102949328 missense probably damaging 1.00
R6243:Nr1h5 UTSW 3 102949064 missense probably benign 0.00
R6442:Nr1h5 UTSW 3 102941111 missense probably damaging 1.00
R6754:Nr1h5 UTSW 3 102949597 missense probably damaging 1.00
R6789:Nr1h5 UTSW 3 102958361 missense possibly damaging 0.81
R7235:Nr1h5 UTSW 3 102949042 critical splice donor site probably null
R7294:Nr1h5 UTSW 3 102945262 missense probably benign 0.00
R7756:Nr1h5 UTSW 3 102949609 missense probably benign 0.00
R7882:Nr1h5 UTSW 3 102949615 missense possibly damaging 0.80
R7965:Nr1h5 UTSW 3 102949615 missense possibly damaging 0.80
X0061:Nr1h5 UTSW 3 102945248 splice site probably null
X0067:Nr1h5 UTSW 3 102949126 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GACATTTGTTCCTACACTAACTGG -3'
(R):5'- TGCTGATAAAAGTGCCCCAAAATAG -3'

Sequencing Primer
(F):5'- AGCAGGGCTTTAAGATCCTCCTTAG -3'
(R):5'- GTTATTCCCCAGAAGCACT -3'
Posted On2016-11-08