Incidental Mutation 'R5617:Samd13'
ID439570
Institutional Source Beutler Lab
Gene Symbol Samd13
Ensembl Gene ENSMUSG00000048652
Gene Namesterile alpha motif domain containing 13
SynonymsLOC381481
MMRRC Submission 043276-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R5617 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146645195-146685592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 146646310 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 95 (K95N)
Ref Sequence ENSEMBL: ENSMUSP00000118934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049703] [ENSMUST00000124931] [ENSMUST00000125965] [ENSMUST00000147113] [ENSMUST00000149825] [ENSMUST00000197989]
Predicted Effect probably benign
Transcript: ENSMUST00000049703
SMART Domains Protein: ENSMUSP00000051453
Gene: ENSMUSG00000090202

DomainStartEndE-ValueType
DnaJ 2 61 1.21e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124931
AA Change: K95N

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118464
Gene: ENSMUSG00000048652
AA Change: K95N

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125965
AA Change: K95N

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000119608
Gene: ENSMUSG00000048652
AA Change: K95N

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141199
Predicted Effect probably benign
Transcript: ENSMUST00000147113
AA Change: K95N

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118934
Gene: ENSMUSG00000048652
AA Change: K95N

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149825
SMART Domains Protein: ENSMUSP00000114745
Gene: ENSMUSG00000090202

DomainStartEndE-ValueType
DnaJ 2 61 1.21e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154128
Predicted Effect probably benign
Transcript: ENSMUST00000197989
AA Change: K76N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143496
Gene: ENSMUSG00000048652
AA Change: K76N

DomainStartEndE-ValueType
SAM 9 75 2.2e-4 SMART
Meta Mutation Damage Score 0.0647 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,277,891 L645F probably benign Het
Acss3 T C 10: 106,951,990 Y522C probably damaging Het
Asb18 A G 1: 89,954,462 V118A possibly damaging Het
Aste1 T A 9: 105,397,835 C8S probably benign Het
Atp10a A G 7: 58,803,675 S834G probably benign Het
Cdh18 A G 15: 23,226,768 D105G probably damaging Het
Cenpb T C 2: 131,179,014 E288G probably damaging Het
Clcnka C T 4: 141,389,317 G541D probably null Het
Dctn3 T C 4: 41,716,407 I134V possibly damaging Het
Dennd4b T C 3: 90,275,626 S917P probably benign Het
Fam135b A T 15: 71,622,016 D21E probably damaging Het
Fam174a T C 1: 95,314,247 V144A probably damaging Het
Fbxo38 A G 18: 62,505,971 Y1087H probably damaging Het
Gm7275 A T 16: 48,074,164 noncoding transcript Het
Gm9271 G T 7: 39,363,652 noncoding transcript Het
Grm2 T C 9: 106,651,076 probably null Het
Hrasls A T 16: 29,220,410 R81* probably null Het
Htt T A 5: 34,870,806 V1802D possibly damaging Het
Ighv1-75 C A 12: 115,834,254 G16V probably benign Het
Krt78 G A 15: 101,947,609 T589I probably damaging Het
Lama3 T C 18: 12,498,936 probably benign Het
Lbr A T 1: 181,828,902 V227D probably benign Het
Lsamp T C 16: 42,134,423 V211A probably damaging Het
Map3k19 G A 1: 127,822,966 R883C probably damaging Het
March8 A C 6: 116,403,520 I111L possibly damaging Het
Mrps10 T A 17: 47,378,242 M187K probably benign Het
Ncdn G A 4: 126,745,047 R660C probably damaging Het
Notum A T 11: 120,656,345 Y332* probably null Het
Nr1h5 A T 3: 102,947,829 L319I probably damaging Het
Olfr1082 T A 2: 86,594,001 I276L probably benign Het
Olfr635 A T 7: 103,979,714 H180L possibly damaging Het
Osbpl5 T C 7: 143,692,947 D765G possibly damaging Het
Parp3 C T 9: 106,474,505 V170M possibly damaging Het
Pcdh15 A G 10: 74,635,672 probably benign Het
Pcdha9 T G 18: 36,998,816 S313A probably benign Het
Pfkm A G 15: 98,122,226 R201G possibly damaging Het
Pgm5 G A 19: 24,750,401 R375* probably null Het
Phactr2 A G 10: 13,474,065 S72P possibly damaging Het
Plec A G 15: 76,174,532 L3600P probably damaging Het
Pou6f1 G A 15: 100,585,993 T208M possibly damaging Het
Rabep1 C T 11: 70,917,529 S394L probably damaging Het
Ranbp2 T G 10: 58,465,667 F687C probably damaging Het
Ranbp6 A G 19: 29,812,463 F163S probably damaging Het
Rcor3 T C 1: 192,120,130 N240D probably benign Het
Slc25a17 G T 15: 81,360,774 probably benign Het
Slfn8 G T 11: 83,004,721 H420N probably benign Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Stim2 G A 5: 54,109,733 E21K probably damaging Het
Tmem163 A G 1: 127,551,330 Y151H possibly damaging Het
Trio A G 15: 27,902,748 I209T probably benign Het
Tubal3 T A 13: 3,933,432 L404H probably damaging Het
Ubqln3 A G 7: 104,142,433 F150S probably damaging Het
Ubr5 T C 15: 38,030,657 S425G possibly damaging Het
Vmn2r52 T A 7: 10,170,934 H326L probably damaging Het
Other mutations in Samd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03290:Samd13 APN 3 146646315 missense probably benign 0.31
R1626:Samd13 UTSW 3 146662726 missense probably benign 0.40
R1699:Samd13 UTSW 3 146662714 missense probably benign 0.01
R1717:Samd13 UTSW 3 146646315 missense probably benign 0.31
R1919:Samd13 UTSW 3 146662712 missense probably benign
R2289:Samd13 UTSW 3 146662691 missense probably damaging 0.99
R4923:Samd13 UTSW 3 146662747 missense probably benign 0.06
R5964:Samd13 UTSW 3 146680696 intron probably benign
R6957:Samd13 UTSW 3 146662669 critical splice donor site probably null
R7250:Samd13 UTSW 3 146646324 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TTTTGCTCCTCCAGGCTGAG -3'
(R):5'- TGGTGTGACTTCAGCCTTCC -3'

Sequencing Primer
(F):5'- TGAGTCAGGCCAGCTGATG -3'
(R):5'- CCATTCCCCCAGAGTGCCTG -3'
Posted On2016-11-08