Incidental Mutation 'R5617:Stim2'
ID439576
Institutional Source Beutler Lab
Gene Symbol Stim2
Ensembl Gene ENSMUSG00000039156
Gene Namestromal interaction molecule 2
Synonyms
MMRRC Submission 043276-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5617 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location53998499-54121057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54109733 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 21 (E21K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117661] [ENSMUST00000201469]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117661
AA Change: E338K

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113174
Gene: ENSMUSG00000039156
AA Change: E338K

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
PDB:3TEQ|D 348 448 2e-38 PDB
low complexity region 505 518 N/A INTRINSIC
low complexity region 527 557 N/A INTRINSIC
low complexity region 602 613 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
Predicted Effect not run
Transcript: ENSMUST00000152812
AA Change: E21K
Predicted Effect probably damaging
Transcript: ENSMUST00000201198
AA Change: E21K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000201469
AA Change: E338K

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143855
Gene: ENSMUSG00000039156
AA Change: E338K

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
Pfam:SOAR 345 453 1.7e-42 PFAM
low complexity region 513 526 N/A INTRINSIC
low complexity region 535 565 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Meta Mutation Damage Score 0.1824 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the stromal interaction molecule (STIM) family and likely arose, along with related family member STIM1, from a common ancestral gene. The encoded protein functions to regulate calcium concentrations in the cytosol and endoplasmic reticulum, and is involved in the activation of plasma membrane Orai Ca(2+) entry channels. This gene initiates translation from a non-AUG (UUG) start site. A signal peptide is cleaved from the resulting protein. Multiple transcript variants result from alternative splicing. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit a slight growth delay and premature death while embryonic fibroblasts show reduced store-operated Ca2+ influx. Mice homozygous for a different null allele show increased neuron survival under hypoxic conditions and resistance to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,277,891 L645F probably benign Het
Acss3 T C 10: 106,951,990 Y522C probably damaging Het
Asb18 A G 1: 89,954,462 V118A possibly damaging Het
Aste1 T A 9: 105,397,835 C8S probably benign Het
Atp10a A G 7: 58,803,675 S834G probably benign Het
Cdh18 A G 15: 23,226,768 D105G probably damaging Het
Cenpb T C 2: 131,179,014 E288G probably damaging Het
Clcnka C T 4: 141,389,317 G541D probably null Het
Dctn3 T C 4: 41,716,407 I134V possibly damaging Het
Dennd4b T C 3: 90,275,626 S917P probably benign Het
Fam135b A T 15: 71,622,016 D21E probably damaging Het
Fam174a T C 1: 95,314,247 V144A probably damaging Het
Fbxo38 A G 18: 62,505,971 Y1087H probably damaging Het
Gm7275 A T 16: 48,074,164 noncoding transcript Het
Gm9271 G T 7: 39,363,652 noncoding transcript Het
Grm2 T C 9: 106,651,076 probably null Het
Hrasls A T 16: 29,220,410 R81* probably null Het
Htt T A 5: 34,870,806 V1802D possibly damaging Het
Ighv1-75 C A 12: 115,834,254 G16V probably benign Het
Krt78 G A 15: 101,947,609 T589I probably damaging Het
Lama3 T C 18: 12,498,936 probably benign Het
Lbr A T 1: 181,828,902 V227D probably benign Het
Lsamp T C 16: 42,134,423 V211A probably damaging Het
Map3k19 G A 1: 127,822,966 R883C probably damaging Het
March8 A C 6: 116,403,520 I111L possibly damaging Het
Mrps10 T A 17: 47,378,242 M187K probably benign Het
Ncdn G A 4: 126,745,047 R660C probably damaging Het
Notum A T 11: 120,656,345 Y332* probably null Het
Nr1h5 A T 3: 102,947,829 L319I probably damaging Het
Olfr1082 T A 2: 86,594,001 I276L probably benign Het
Olfr635 A T 7: 103,979,714 H180L possibly damaging Het
Osbpl5 T C 7: 143,692,947 D765G possibly damaging Het
Parp3 C T 9: 106,474,505 V170M possibly damaging Het
Pcdh15 A G 10: 74,635,672 probably benign Het
Pcdha9 T G 18: 36,998,816 S313A probably benign Het
Pfkm A G 15: 98,122,226 R201G possibly damaging Het
Pgm5 G A 19: 24,750,401 R375* probably null Het
Phactr2 A G 10: 13,474,065 S72P possibly damaging Het
Plec A G 15: 76,174,532 L3600P probably damaging Het
Pou6f1 G A 15: 100,585,993 T208M possibly damaging Het
Rabep1 C T 11: 70,917,529 S394L probably damaging Het
Ranbp2 T G 10: 58,465,667 F687C probably damaging Het
Ranbp6 A G 19: 29,812,463 F163S probably damaging Het
Rcor3 T C 1: 192,120,130 N240D probably benign Het
Samd13 C A 3: 146,646,310 K95N probably benign Het
Slc25a17 G T 15: 81,360,774 probably benign Het
Slfn8 G T 11: 83,004,721 H420N probably benign Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Tmem163 A G 1: 127,551,330 Y151H possibly damaging Het
Trio A G 15: 27,902,748 I209T probably benign Het
Tubal3 T A 13: 3,933,432 L404H probably damaging Het
Ubqln3 A G 7: 104,142,433 F150S probably damaging Het
Ubr5 T C 15: 38,030,657 S425G possibly damaging Het
Vmn2r52 T A 7: 10,170,934 H326L probably damaging Het
Other mutations in Stim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Stim2 APN 5 54053493 missense probably benign 0.09
IGL02276:Stim2 APN 5 54053370 splice site probably benign
IGL02643:Stim2 APN 5 54110613 missense probably damaging 1.00
R0368:Stim2 UTSW 5 54110140 critical splice donor site probably null
R0825:Stim2 UTSW 5 54118483 missense probably benign 0.22
R1453:Stim2 UTSW 5 54116109 missense probably damaging 1.00
R1549:Stim2 UTSW 5 54105325 missense probably damaging 1.00
R2103:Stim2 UTSW 5 54105249 missense possibly damaging 0.74
R2114:Stim2 UTSW 5 54104477 missense probably damaging 1.00
R2147:Stim2 UTSW 5 54105375 missense probably damaging 1.00
R2159:Stim2 UTSW 5 54109814 missense probably damaging 1.00
R4467:Stim2 UTSW 5 54116194 critical splice donor site probably null
R4809:Stim2 UTSW 5 54110613 missense probably damaging 1.00
R4857:Stim2 UTSW 5 54118546 missense probably damaging 1.00
R4959:Stim2 UTSW 5 54105370 missense probably benign
R5125:Stim2 UTSW 5 54110597 missense probably damaging 1.00
R5427:Stim2 UTSW 5 54110939 missense possibly damaging 0.95
R5441:Stim2 UTSW 5 54075370 nonsense probably null
R5924:Stim2 UTSW 5 54102643 missense probably benign 0.01
R6169:Stim2 UTSW 5 54118679 missense probably damaging 1.00
R6689:Stim2 UTSW 5 54115976 missense probably damaging 1.00
R6893:Stim2 UTSW 5 54053445 missense probably benign 0.13
R6971:Stim2 UTSW 5 54118299 nonsense probably null
R7133:Stim2 UTSW 5 53998921 missense possibly damaging 0.70
R7189:Stim2 UTSW 5 54116128 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTCAAGGCAGCACTAGTTTTG -3'
(R):5'- TCTTCAAGAAGGGCTTTTACTGAGG -3'

Sequencing Primer
(F):5'- GGCAGCACTAGTTTTGAAATAAATC -3'
(R):5'- GCTTTTACTGAGGTCTTTGAATTCC -3'
Posted On2016-11-08