Incidental Mutation 'R5617:Olfr635'
ID439580
Institutional Source Beutler Lab
Gene Symbol Olfr635
Ensembl Gene ENSMUSG00000094520
Gene Nameolfactory receptor 635
SynonymsGA_x6K02T2PBJ9-6713641-6714588, MOR5-2
MMRRC Submission 043276-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R5617 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103971152-103987540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103979714 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 180 (H180L)
Ref Sequence ENSEMBL: ENSMUSP00000095788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098185] [ENSMUST00000209473]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098185
AA Change: H180L

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095788
Gene: ENSMUSG00000094520
AA Change: H180L

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 1.2e-119 PFAM
Pfam:7TM_GPCR_Srsx 43 182 1.3e-9 PFAM
Pfam:7tm_1 49 300 1.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121874
Predicted Effect possibly damaging
Transcript: ENSMUST00000209473
AA Change: H174L

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.3693 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,277,891 L645F probably benign Het
Acss3 T C 10: 106,951,990 Y522C probably damaging Het
Asb18 A G 1: 89,954,462 V118A possibly damaging Het
Aste1 T A 9: 105,397,835 C8S probably benign Het
Atp10a A G 7: 58,803,675 S834G probably benign Het
Cdh18 A G 15: 23,226,768 D105G probably damaging Het
Cenpb T C 2: 131,179,014 E288G probably damaging Het
Clcnka C T 4: 141,389,317 G541D probably null Het
Dctn3 T C 4: 41,716,407 I134V possibly damaging Het
Dennd4b T C 3: 90,275,626 S917P probably benign Het
Fam135b A T 15: 71,622,016 D21E probably damaging Het
Fam174a T C 1: 95,314,247 V144A probably damaging Het
Fbxo38 A G 18: 62,505,971 Y1087H probably damaging Het
Gm7275 A T 16: 48,074,164 noncoding transcript Het
Gm9271 G T 7: 39,363,652 noncoding transcript Het
Grm2 T C 9: 106,651,076 probably null Het
Hrasls A T 16: 29,220,410 R81* probably null Het
Htt T A 5: 34,870,806 V1802D possibly damaging Het
Ighv1-75 C A 12: 115,834,254 G16V probably benign Het
Krt78 G A 15: 101,947,609 T589I probably damaging Het
Lama3 T C 18: 12,498,936 probably benign Het
Lbr A T 1: 181,828,902 V227D probably benign Het
Lsamp T C 16: 42,134,423 V211A probably damaging Het
Map3k19 G A 1: 127,822,966 R883C probably damaging Het
March8 A C 6: 116,403,520 I111L possibly damaging Het
Mrps10 T A 17: 47,378,242 M187K probably benign Het
Ncdn G A 4: 126,745,047 R660C probably damaging Het
Notum A T 11: 120,656,345 Y332* probably null Het
Nr1h5 A T 3: 102,947,829 L319I probably damaging Het
Olfr1082 T A 2: 86,594,001 I276L probably benign Het
Osbpl5 T C 7: 143,692,947 D765G possibly damaging Het
Parp3 C T 9: 106,474,505 V170M possibly damaging Het
Pcdh15 A G 10: 74,635,672 probably benign Het
Pcdha9 T G 18: 36,998,816 S313A probably benign Het
Pfkm A G 15: 98,122,226 R201G possibly damaging Het
Pgm5 G A 19: 24,750,401 R375* probably null Het
Phactr2 A G 10: 13,474,065 S72P possibly damaging Het
Plec A G 15: 76,174,532 L3600P probably damaging Het
Pou6f1 G A 15: 100,585,993 T208M possibly damaging Het
Rabep1 C T 11: 70,917,529 S394L probably damaging Het
Ranbp2 T G 10: 58,465,667 F687C probably damaging Het
Ranbp6 A G 19: 29,812,463 F163S probably damaging Het
Rcor3 T C 1: 192,120,130 N240D probably benign Het
Samd13 C A 3: 146,646,310 K95N probably benign Het
Slc25a17 G T 15: 81,360,774 probably benign Het
Slfn8 G T 11: 83,004,721 H420N probably benign Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Stim2 G A 5: 54,109,733 E21K probably damaging Het
Tmem163 A G 1: 127,551,330 Y151H possibly damaging Het
Trio A G 15: 27,902,748 I209T probably benign Het
Tubal3 T A 13: 3,933,432 L404H probably damaging Het
Ubqln3 A G 7: 104,142,433 F150S probably damaging Het
Ubr5 T C 15: 38,030,657 S425G possibly damaging Het
Vmn2r52 T A 7: 10,170,934 H326L probably damaging Het
Other mutations in Olfr635
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr635 APN 7 103979792 missense probably benign 0.09
IGL01330:Olfr635 APN 7 103980142 utr 3 prime probably benign
IGL01433:Olfr635 APN 7 103979332 missense probably damaging 1.00
FR4304:Olfr635 UTSW 7 103979903 frame shift probably null
FR4340:Olfr635 UTSW 7 103979903 frame shift probably null
FR4342:Olfr635 UTSW 7 103979903 frame shift probably null
R0271:Olfr635 UTSW 7 103979630 missense possibly damaging 0.83
R1909:Olfr635 UTSW 7 103979790 nonsense probably null
R2212:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R2484:Olfr635 UTSW 7 103979338 missense probably benign
R3412:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R4513:Olfr635 UTSW 7 103979441 missense probably benign 0.03
R4559:Olfr635 UTSW 7 103979560 missense probably damaging 1.00
R5032:Olfr635 UTSW 7 103979374 missense probably damaging 0.98
R5436:Olfr635 UTSW 7 103979266 missense probably benign
R5591:Olfr635 UTSW 7 103980113 missense probably benign 0.00
R5911:Olfr635 UTSW 7 103979708 missense probably benign
R6249:Olfr635 UTSW 7 103979611 missense possibly damaging 0.85
R6275:Olfr635 UTSW 7 103979974 missense probably damaging 1.00
R6806:Olfr635 UTSW 7 103979564 missense possibly damaging 0.72
R7589:Olfr635 UTSW 7 103979791 missense probably damaging 1.00
RF004:Olfr635 UTSW 7 103979903 frame shift probably null
RF005:Olfr635 UTSW 7 103979561 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAAATCAGCTTTGAGGCCTG -3'
(R):5'- CCAAGTGGCTGTGTTCAAGAC -3'

Sequencing Primer
(F):5'- ATGGAATCATCTGTTCTATTGGCC -3'
(R):5'- CACTCTTCAGGATAAGTGCATAGG -3'
Posted On2016-11-08