Mutagenetix > Incidental Mutations

Incidental Mutation 'R5617:Slfn8'

439593

Institutional Source

Beutler Lab

Gene Symbol

Slfn8

Ensembl Gene

ENSMUSG00000035208

Gene Name

schlafen 8

Synonyms

MMRRC Submission

043276-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R5617 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83002158-83020810 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 83004721 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 420 (H420N)

Ref Sequence

ENSEMBL: ENSMUSP00000114417 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]

Predicted Effect

probably benign
Transcript: ENSMUST00000038141
AA Change: H420N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: H420N

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	1.6e-18	PFAM
Pfam:DUF2075	592	766	5.8e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000092838
AA Change: H420N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: H420N

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	205	341	1.4e-17	PFAM
Pfam:DUF2075	592	767	2.2e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108152

SMART Domains

Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	4.1e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130822
AA Change: H420N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208
AA Change: H420N

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	3.7e-19	PFAM
SCOP:d1ly1a_	593	625	4e-3	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000131883
AA Change: H196N

SMART Domains

Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208
AA Change: H196N

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	27	163	1.8e-15	PFAM
SCOP:d1ly1a_	370	402	2e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000215239

Meta Mutation Damage Score

0.4972

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (59/59)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	C	T	11: 9,277,891	L645F	probably benign	Het
Acss3	T	C	10: 106,951,990	Y522C	probably damaging	Het
Asb18	A	G	1: 89,954,462	V118A	possibly damaging	Het
Aste1	T	A	9: 105,397,835	C8S	probably benign	Het
Atp10a	A	G	7: 58,803,675	S834G	probably benign	Het
Cdh18	A	G	15: 23,226,768	D105G	probably damaging	Het
Cenpb	T	C	2: 131,179,014	E288G	probably damaging	Het
Clcnka	C	T	4: 141,389,317	G541D	probably null	Het
Dctn3	T	C	4: 41,716,407	I134V	possibly damaging	Het
Dennd4b	T	C	3: 90,275,626	S917P	probably benign	Het
Fam135b	A	T	15: 71,622,016	D21E	probably damaging	Het
Fam174a	T	C	1: 95,314,247	V144A	probably damaging	Het
Fbxo38	A	G	18: 62,505,971	Y1087H	probably damaging	Het
Gm7275	A	T	16: 48,074,164		noncoding transcript	Het
Gm9271	G	T	7: 39,363,652		noncoding transcript	Het
Grm2	T	C	9: 106,651,076		probably null	Het
Hrasls	A	T	16: 29,220,410	R81*	probably null	Het
Htt	T	A	5: 34,870,806	V1802D	possibly damaging	Het
Ighv1-75	C	A	12: 115,834,254	G16V	probably benign	Het
Krt78	G	A	15: 101,947,609	T589I	probably damaging	Het
Lama3	T	C	18: 12,498,936		probably benign	Het
Lbr	A	T	1: 181,828,902	V227D	probably benign	Het
Lsamp	T	C	16: 42,134,423	V211A	probably damaging	Het
Map3k19	G	A	1: 127,822,966	R883C	probably damaging	Het
March8	A	C	6: 116,403,520	I111L	possibly damaging	Het
Mrps10	T	A	17: 47,378,242	M187K	probably benign	Het
Ncdn	G	A	4: 126,745,047	R660C	probably damaging	Het
Notum	A	T	11: 120,656,345	Y332*	probably null	Het
Nr1h5	A	T	3: 102,947,829	L319I	probably damaging	Het
Olfr1082	T	A	2: 86,594,001	I276L	probably benign	Het
Olfr635	A	T	7: 103,979,714	H180L	possibly damaging	Het
Osbpl5	T	C	7: 143,692,947	D765G	possibly damaging	Het
Parp3	C	T	9: 106,474,505	V170M	possibly damaging	Het
Pcdh15	A	G	10: 74,635,672		probably benign	Het
Pcdha9	T	G	18: 36,998,816	S313A	probably benign	Het
Pfkm	A	G	15: 98,122,226	R201G	possibly damaging	Het
Pgm5	G	A	19: 24,750,401	R375*	probably null	Het
Phactr2	A	G	10: 13,474,065	S72P	possibly damaging	Het
Plec	A	G	15: 76,174,532	L3600P	probably damaging	Het
Pou6f1	G	A	15: 100,585,993	T208M	possibly damaging	Het
Rabep1	C	T	11: 70,917,529	S394L	probably damaging	Het
Ranbp2	T	G	10: 58,465,667	F687C	probably damaging	Het
Ranbp6	A	G	19: 29,812,463	F163S	probably damaging	Het
Rcor3	T	C	1: 192,120,130	N240D	probably benign	Het
Samd13	C	A	3: 146,646,310	K95N	probably benign	Het
Slc25a17	G	T	15: 81,360,774		probably benign	Het
Sptbn5	G	A	2: 120,046,484		probably benign	Het
Stim2	G	A	5: 54,109,733	E21K	probably damaging	Het
Tmem163	A	G	1: 127,551,330	Y151H	possibly damaging	Het
Trio	A	G	15: 27,902,748	I209T	probably benign	Het
Tubal3	T	A	13: 3,933,432	L404H	probably damaging	Het
Ubqln3	A	G	7: 104,142,433	F150S	probably damaging	Het
Ubr5	T	C	15: 38,030,657	S425G	possibly damaging	Het
Vmn2r52	T	A	7: 10,170,934	H326L	probably damaging	Het

Other mutations in Slfn8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Slfn8	APN	11	83013484	missense	possibly damaging	0.75
IGL01418:Slfn8	APN	11	83004636	missense	probably damaging	1.00
IGL01620:Slfn8	APN	11	83004233	nonsense	probably null
IGL01875:Slfn8	APN	11	83004079	missense	probably benign	0.30
IGL01896:Slfn8	APN	11	83003696	missense	probably damaging	1.00
IGL01929:Slfn8	APN	11	83003405	nonsense	probably null
IGL02111:Slfn8	APN	11	83004498	missense	probably damaging	1.00
IGL02136:Slfn8	APN	11	83003465	nonsense	probably null
IGL02165:Slfn8	APN	11	83017196	missense	probably benign	0.00
IGL02645:Slfn8	APN	11	83003554	missense	possibly damaging	0.82
IGL02682:Slfn8	APN	11	83003691	missense	probably damaging	1.00
IGL02689:Slfn8	APN	11	83017108	missense	probably damaging	1.00
IGL02948:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03037:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03185:Slfn8	APN	11	83017507	missense	probably benign	0.01
IGL03243:Slfn8	APN	11	83003707	missense	probably damaging	1.00
IGL03286:Slfn8	APN	11	83013468	missense	probably damaging	0.99
R0295:Slfn8	UTSW	11	83003343	nonsense	probably null
R0368:Slfn8	UTSW	11	83017132	missense	probably damaging	1.00
R0382:Slfn8	UTSW	11	83004556	missense	probably damaging	1.00
R0655:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R0894:Slfn8	UTSW	11	83003581	missense	probably benign	0.07
R1006:Slfn8	UTSW	11	83003511	missense	possibly damaging	0.69
R1181:Slfn8	UTSW	11	83016745	missense	probably benign	0.19
R1187:Slfn8	UTSW	11	83003488	missense	probably damaging	1.00
R1501:Slfn8	UTSW	11	83003180	missense	probably damaging	0.99
R1646:Slfn8	UTSW	11	83016886	missense	probably damaging	1.00
R1909:Slfn8	UTSW	11	83003621	nonsense	probably null
R2005:Slfn8	UTSW	11	83004150	missense	probably damaging	1.00
R2363:Slfn8	UTSW	11	83004094	missense	probably damaging	1.00
R3780:Slfn8	UTSW	11	83017454	missense	probably benign	0.13
R3890:Slfn8	UTSW	11	83004444	missense	possibly damaging	0.68
R3917:Slfn8	UTSW	11	83016993	nonsense	probably null
R4559:Slfn8	UTSW	11	83004744	missense	probably damaging	1.00
R4684:Slfn8	UTSW	11	83017506	missense	probably benign	0.10
R4767:Slfn8	UTSW	11	83003197	missense	possibly damaging	0.66
R4773:Slfn8	UTSW	11	83017393	missense	probably damaging	1.00
R4859:Slfn8	UTSW	11	83017714	start codon destroyed	probably null	0.99
R4916:Slfn8	UTSW	11	83016878	missense	probably damaging	1.00
R4939:Slfn8	UTSW	11	83003285	missense	probably benign	0.01
R5107:Slfn8	UTSW	11	83017150	missense	probably damaging	0.99
R5130:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R5165:Slfn8	UTSW	11	83017127	missense	probably damaging	0.99
R5238:Slfn8	UTSW	11	83013388	missense	probably damaging	0.96
R5282:Slfn8	UTSW	11	83017724	critical splice acceptor site	probably null
R5311:Slfn8	UTSW	11	83004084	missense	probably damaging	1.00
R5499:Slfn8	UTSW	11	83004216	missense	probably damaging	0.99
R5782:Slfn8	UTSW	11	83017041	missense	probably damaging	0.98
R5823:Slfn8	UTSW	11	83016736	missense	probably benign	0.01
R5886:Slfn8	UTSW	11	83003334	missense	probably benign	0.09
R5933:Slfn8	UTSW	11	83003335	missense	probably benign	0.00
R6151:Slfn8	UTSW	11	83017321	missense	probably damaging	1.00
R6163:Slfn8	UTSW	11	83003864	makesense	probably null
R6191:Slfn8	UTSW	11	83016800	missense	possibly damaging	0.72
R6419:Slfn8	UTSW	11	83004055	unclassified	probably null
R6925:Slfn8	UTSW	11	83013417	nonsense	probably null
R7065:Slfn8	UTSW	11	83016968	missense	probably benign	0.01
R7380:Slfn8	UTSW	11	83003740	missense	not run
R7414:Slfn8	UTSW	11	83016792	nonsense	probably null
R7819:Slfn8	UTSW	11	83004255	missense	probably damaging	1.00
X0021:Slfn8	UTSW	11	83016928	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- TTCTGCTTCAGAGTAAAGGCAG -3'
(R):5'- TGCAGAAGTATTGGTCACCTAC -3'

Sequencing Primer
(F):5'- GTTGCAGTAGTCCTGACCCTG -3'
(R):5'- AGTATTGGTCACCTACTTAATTCTCC -3'

Posted On

2016-11-08