Incidental Mutation 'R5617:Cdh18'
ID439597
Institutional Source Beutler Lab
Gene Symbol Cdh18
Ensembl Gene ENSMUSG00000040420
Gene Namecadherin 18
Synonyms
MMRRC Submission 043276-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5617 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location22549022-23474418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23226768 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 105 (D105G)
Ref Sequence ENSEMBL: ENSMUSP00000128643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163361] [ENSMUST00000164787] [ENSMUST00000165614] [ENSMUST00000167623] [ENSMUST00000226693]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000040427
Predicted Effect probably benign
Transcript: ENSMUST00000163361
AA Change: D105G

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129170
Gene: ENSMUSG00000040420
AA Change: D105G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
Pfam:Cadherin 273 337 2.8e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164787
AA Change: D105G

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130851
Gene: ENSMUSG00000040420
AA Change: D105G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
CA 509 596 3.7e-5 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 6.8e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165614
AA Change: D105G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128643
Gene: ENSMUSG00000040420
AA Change: D105G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167623
AA Change: D51G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128011
Gene: ENSMUSG00000040420
AA Change: D51G

DomainStartEndE-ValueType
CA 22 103 4.24e-14 SMART
CA 127 212 1.37e-31 SMART
CA 236 328 2.76e-13 SMART
CA 351 414 4.15e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226693
AA Change: D105G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.3532 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,277,891 L645F probably benign Het
Acss3 T C 10: 106,951,990 Y522C probably damaging Het
Asb18 A G 1: 89,954,462 V118A possibly damaging Het
Aste1 T A 9: 105,397,835 C8S probably benign Het
Atp10a A G 7: 58,803,675 S834G probably benign Het
Cenpb T C 2: 131,179,014 E288G probably damaging Het
Clcnka C T 4: 141,389,317 G541D probably null Het
Dctn3 T C 4: 41,716,407 I134V possibly damaging Het
Dennd4b T C 3: 90,275,626 S917P probably benign Het
Fam135b A T 15: 71,622,016 D21E probably damaging Het
Fam174a T C 1: 95,314,247 V144A probably damaging Het
Fbxo38 A G 18: 62,505,971 Y1087H probably damaging Het
Gm7275 A T 16: 48,074,164 noncoding transcript Het
Gm9271 G T 7: 39,363,652 noncoding transcript Het
Grm2 T C 9: 106,651,076 probably null Het
Hrasls A T 16: 29,220,410 R81* probably null Het
Htt T A 5: 34,870,806 V1802D possibly damaging Het
Ighv1-75 C A 12: 115,834,254 G16V probably benign Het
Krt78 G A 15: 101,947,609 T589I probably damaging Het
Lama3 T C 18: 12,498,936 probably benign Het
Lbr A T 1: 181,828,902 V227D probably benign Het
Lsamp T C 16: 42,134,423 V211A probably damaging Het
Map3k19 G A 1: 127,822,966 R883C probably damaging Het
March8 A C 6: 116,403,520 I111L possibly damaging Het
Mrps10 T A 17: 47,378,242 M187K probably benign Het
Ncdn G A 4: 126,745,047 R660C probably damaging Het
Notum A T 11: 120,656,345 Y332* probably null Het
Nr1h5 A T 3: 102,947,829 L319I probably damaging Het
Olfr1082 T A 2: 86,594,001 I276L probably benign Het
Olfr635 A T 7: 103,979,714 H180L possibly damaging Het
Osbpl5 T C 7: 143,692,947 D765G possibly damaging Het
Parp3 C T 9: 106,474,505 V170M possibly damaging Het
Pcdh15 A G 10: 74,635,672 probably benign Het
Pcdha9 T G 18: 36,998,816 S313A probably benign Het
Pfkm A G 15: 98,122,226 R201G possibly damaging Het
Pgm5 G A 19: 24,750,401 R375* probably null Het
Phactr2 A G 10: 13,474,065 S72P possibly damaging Het
Plec A G 15: 76,174,532 L3600P probably damaging Het
Pou6f1 G A 15: 100,585,993 T208M possibly damaging Het
Rabep1 C T 11: 70,917,529 S394L probably damaging Het
Ranbp2 T G 10: 58,465,667 F687C probably damaging Het
Ranbp6 A G 19: 29,812,463 F163S probably damaging Het
Rcor3 T C 1: 192,120,130 N240D probably benign Het
Samd13 C A 3: 146,646,310 K95N probably benign Het
Slc25a17 G T 15: 81,360,774 probably benign Het
Slfn8 G T 11: 83,004,721 H420N probably benign Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Stim2 G A 5: 54,109,733 E21K probably damaging Het
Tmem163 A G 1: 127,551,330 Y151H possibly damaging Het
Trio A G 15: 27,902,748 I209T probably benign Het
Tubal3 T A 13: 3,933,432 L404H probably damaging Het
Ubqln3 A G 7: 104,142,433 F150S probably damaging Het
Ubr5 T C 15: 38,030,657 S425G possibly damaging Het
Vmn2r52 T A 7: 10,170,934 H326L probably damaging Het
Other mutations in Cdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Cdh18 APN 15 23173796 missense probably damaging 0.97
IGL01663:Cdh18 APN 15 23445991 missense possibly damaging 0.92
IGL01758:Cdh18 APN 15 23474183 missense probably benign 0.20
IGL02192:Cdh18 APN 15 23460316 missense probably damaging 1.00
IGL02448:Cdh18 APN 15 23173789 missense probably benign 0.00
IGL02717:Cdh18 APN 15 23410715 nonsense probably null
IGL03241:Cdh18 APN 15 23226933 missense probably benign 0.19
IGL03268:Cdh18 APN 15 23366867 missense probably damaging 1.00
IGL03307:Cdh18 APN 15 23226786 missense probably damaging 1.00
R0316:Cdh18 UTSW 15 23366913 missense probably damaging 1.00
R0462:Cdh18 UTSW 15 23366885 missense probably damaging 1.00
R0607:Cdh18 UTSW 15 23410790 missense probably benign 0.01
R0761:Cdh18 UTSW 15 23226752 missense possibly damaging 0.87
R0973:Cdh18 UTSW 15 23473995 missense probably damaging 0.99
R1110:Cdh18 UTSW 15 23474317 missense probably benign 0.00
R1550:Cdh18 UTSW 15 23436548 missense probably damaging 1.00
R1656:Cdh18 UTSW 15 23474399 missense probably benign 0.38
R1682:Cdh18 UTSW 15 23400585 missense probably benign 0.05
R1770:Cdh18 UTSW 15 23474401 missense probably benign
R1829:Cdh18 UTSW 15 23173852 missense probably damaging 1.00
R2253:Cdh18 UTSW 15 23410805 missense probably benign 0.00
R2435:Cdh18 UTSW 15 23367008 missense probably damaging 1.00
R3914:Cdh18 UTSW 15 23410685 missense probably damaging 1.00
R3964:Cdh18 UTSW 15 23474101 missense probably benign
R4002:Cdh18 UTSW 15 23382962 missense possibly damaging 0.48
R4291:Cdh18 UTSW 15 22714551 intron probably benign
R4581:Cdh18 UTSW 15 23226783 missense probably damaging 1.00
R4604:Cdh18 UTSW 15 23474368 missense probably benign 0.05
R4625:Cdh18 UTSW 15 22714042 intron probably benign
R4786:Cdh18 UTSW 15 23410787 missense probably null 1.00
R4811:Cdh18 UTSW 15 23226791 missense probably benign 0.30
R5023:Cdh18 UTSW 15 23259666 missense probably damaging 1.00
R5094:Cdh18 UTSW 15 22714539 intron probably benign
R5278:Cdh18 UTSW 15 23474158 missense probably benign 0.04
R5416:Cdh18 UTSW 15 23226723 missense probably damaging 1.00
R5503:Cdh18 UTSW 15 23436534 missense probably damaging 0.96
R5982:Cdh18 UTSW 15 23474216 missense possibly damaging 0.89
R6240:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6475:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6649:Cdh18 UTSW 15 23436534 missense possibly damaging 0.87
R6700:Cdh18 UTSW 15 23474105 missense probably benign
R6718:Cdh18 UTSW 15 23226749 missense probably benign 0.15
R6796:Cdh18 UTSW 15 23446073 missense probably damaging 1.00
R7330:Cdh18 UTSW 15 23226950 missense possibly damaging 0.46
R7429:Cdh18 UTSW 15 23366856 missense possibly damaging 0.89
R7477:Cdh18 UTSW 15 23410725 missense probably benign
R7516:Cdh18 UTSW 15 23259598 splice site probably null
R7519:Cdh18 UTSW 15 23474212 missense possibly damaging 0.68
R7575:Cdh18 UTSW 15 23400597 nonsense probably null
R7618:Cdh18 UTSW 15 23366970 missense probably damaging 1.00
R7844:Cdh18 UTSW 15 23410787 missense probably damaging 1.00
R7870:Cdh18 UTSW 15 23474327 missense possibly damaging 0.94
R7927:Cdh18 UTSW 15 23410787 missense probably damaging 1.00
R7953:Cdh18 UTSW 15 23474327 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTATAGCATGAGGTTTCCAGTAAAG -3'
(R):5'- TTTCAGGCACAGTAACGATGTATGG -3'

Sequencing Primer
(F):5'- CAGGTTACAATGCCATCAG -3'
(R):5'- GCACAGTAACGATGTATGGTCCATC -3'
Posted On2016-11-08