Incidental Mutation 'R5617:Lsamp'
ID439607
Institutional Source Beutler Lab
Gene Symbol Lsamp
Ensembl Gene ENSMUSG00000061080
Gene Namelimbic system-associated membrane protein
SynonymsLamp, D930023J12Rik, Lam, B130007O04Rik
MMRRC Submission 043276-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5617 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location39984361-42181679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42134423 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 211 (V211A)
Ref Sequence ENSEMBL: ENSMUSP00000097349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078873] [ENSMUST00000099761] [ENSMUST00000187695]
Predicted Effect probably damaging
Transcript: ENSMUST00000078873
AA Change: V211A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077913
Gene: ENSMUSG00000061080
AA Change: V211A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 129 1.81e-10 SMART
IGc2 144 204 3.7e-16 SMART
IGc2 230 297 2.12e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099761
AA Change: V211A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097349
Gene: ENSMUSG00000061080
AA Change: V211A

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
IG 38 129 1.81e-10 SMART
IGc2 144 204 3.7e-16 SMART
IGc2 230 297 2.12e-16 SMART
transmembrane domain 313 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187695
AA Change: V228A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139667
Gene: ENSMUSG00000061080
AA Change: V228A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 55 146 7.6e-13 SMART
IGc2 161 221 1.5e-18 SMART
IGc2 247 314 8.6e-19 SMART
transmembrane domain 330 352 N/A INTRINSIC
Meta Mutation Damage Score 0.4404 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin LAMP, OBCAM and neurotrimin (IgLON) family of proteins. The encoded preproprotein is proteolytically processed to generate a neuronal surface glycoprotein. This protein may act as a selective homophilic adhesion molecule during axon guidance and neuronal growth in the developing limbic system. The encoded protein may also function as a tumor suppressor and may play a role in neuropsychiatric disorders. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for mutations in this gene are hyperresponsive to novel environments. Mice homozygous for another knock-out allele exhibit reduced barbering, whisker trimming, anxiety, dominance, and aggression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,277,891 L645F probably benign Het
Acss3 T C 10: 106,951,990 Y522C probably damaging Het
Asb18 A G 1: 89,954,462 V118A possibly damaging Het
Aste1 T A 9: 105,397,835 C8S probably benign Het
Atp10a A G 7: 58,803,675 S834G probably benign Het
Cdh18 A G 15: 23,226,768 D105G probably damaging Het
Cenpb T C 2: 131,179,014 E288G probably damaging Het
Clcnka C T 4: 141,389,317 G541D probably null Het
Dctn3 T C 4: 41,716,407 I134V possibly damaging Het
Dennd4b T C 3: 90,275,626 S917P probably benign Het
Fam135b A T 15: 71,622,016 D21E probably damaging Het
Fam174a T C 1: 95,314,247 V144A probably damaging Het
Fbxo38 A G 18: 62,505,971 Y1087H probably damaging Het
Gm7275 A T 16: 48,074,164 noncoding transcript Het
Gm9271 G T 7: 39,363,652 noncoding transcript Het
Grm2 T C 9: 106,651,076 probably null Het
Hrasls A T 16: 29,220,410 R81* probably null Het
Htt T A 5: 34,870,806 V1802D possibly damaging Het
Ighv1-75 C A 12: 115,834,254 G16V probably benign Het
Krt78 G A 15: 101,947,609 T589I probably damaging Het
Lama3 T C 18: 12,498,936 probably benign Het
Lbr A T 1: 181,828,902 V227D probably benign Het
Map3k19 G A 1: 127,822,966 R883C probably damaging Het
March8 A C 6: 116,403,520 I111L possibly damaging Het
Mrps10 T A 17: 47,378,242 M187K probably benign Het
Ncdn G A 4: 126,745,047 R660C probably damaging Het
Notum A T 11: 120,656,345 Y332* probably null Het
Nr1h5 A T 3: 102,947,829 L319I probably damaging Het
Olfr1082 T A 2: 86,594,001 I276L probably benign Het
Olfr635 A T 7: 103,979,714 H180L possibly damaging Het
Osbpl5 T C 7: 143,692,947 D765G possibly damaging Het
Parp3 C T 9: 106,474,505 V170M possibly damaging Het
Pcdh15 A G 10: 74,635,672 probably benign Het
Pcdha9 T G 18: 36,998,816 S313A probably benign Het
Pfkm A G 15: 98,122,226 R201G possibly damaging Het
Pgm5 G A 19: 24,750,401 R375* probably null Het
Phactr2 A G 10: 13,474,065 S72P possibly damaging Het
Plec A G 15: 76,174,532 L3600P probably damaging Het
Pou6f1 G A 15: 100,585,993 T208M possibly damaging Het
Rabep1 C T 11: 70,917,529 S394L probably damaging Het
Ranbp2 T G 10: 58,465,667 F687C probably damaging Het
Ranbp6 A G 19: 29,812,463 F163S probably damaging Het
Rcor3 T C 1: 192,120,130 N240D probably benign Het
Samd13 C A 3: 146,646,310 K95N probably benign Het
Slc25a17 G T 15: 81,360,774 probably benign Het
Slfn8 G T 11: 83,004,721 H420N probably benign Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Stim2 G A 5: 54,109,733 E21K probably damaging Het
Tmem163 A G 1: 127,551,330 Y151H possibly damaging Het
Trio A G 15: 27,902,748 I209T probably benign Het
Tubal3 T A 13: 3,933,432 L404H probably damaging Het
Ubqln3 A G 7: 104,142,433 F150S probably damaging Het
Ubr5 T C 15: 38,030,657 S425G possibly damaging Het
Vmn2r52 T A 7: 10,170,934 H326L probably damaging Het
Other mutations in Lsamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01665:Lsamp APN 16 42144012 nonsense probably null
IGL02869:Lsamp APN 16 42144715 missense probably benign 0.00
R0930:Lsamp UTSW 16 41888964 missense probably benign 0.25
R1147:Lsamp UTSW 16 42174136 splice site probably benign
R1170:Lsamp UTSW 16 42151229 intron probably benign
R1649:Lsamp UTSW 16 41955298 missense probably benign 0.00
R1656:Lsamp UTSW 16 41955319 missense probably damaging 1.00
R1976:Lsamp UTSW 16 41889067 missense probably damaging 0.99
R3613:Lsamp UTSW 16 41955323 missense probably benign 0.03
R3732:Lsamp UTSW 16 42144572 missense probably damaging 1.00
R3734:Lsamp UTSW 16 42144770 missense probably benign
R3838:Lsamp UTSW 16 42134312 missense possibly damaging 0.54
R3890:Lsamp UTSW 16 39984692 missense probably benign 0.01
R3891:Lsamp UTSW 16 39984692 missense probably benign 0.01
R4554:Lsamp UTSW 16 42144075 missense probably damaging 1.00
R4672:Lsamp UTSW 16 41955334 missense probably damaging 1.00
R5151:Lsamp UTSW 16 42134429 missense probably damaging 1.00
R6075:Lsamp UTSW 16 42134425 missense probably benign 0.19
R6217:Lsamp UTSW 16 42134312 missense possibly damaging 0.54
R6477:Lsamp UTSW 16 42168165 intron probably benign
R6637:Lsamp UTSW 16 41533381 missense possibly damaging 0.86
X0024:Lsamp UTSW 16 42144558 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AAGGGCCAAGTCAGCATTG -3'
(R):5'- ATTCAAAGGCCAAGTCTCGC -3'

Sequencing Primer
(F):5'- GCCAAGTCAGCATTGTTTCTAGAG -3'
(R):5'- AAGTCTCGCCCTTGGAAGTGTC -3'
Posted On2016-11-08