Mutagenetix > Incidental Mutations

Incidental Mutation 'R5617:Gm7275'

439608

Institutional Source

Beutler Lab

Gene Symbol

Gm7275

Ensembl Gene

ENSMUSG00000067716

Gene Name

predicted gene 7275

Synonyms

MMRRC Submission

043276-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.211) question?

Stock #

R5617 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48073444-48074187 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

A to T at 48074164 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000085634 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088296]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000088296

SMART Domains

Protein: ENSMUSP00000085634
Gene: ENSMUSG00000067716

Domain	Start	End	E-Value	Type
Pfam:Peptidase_C48	67	246	1e-43	PFAM

Meta Mutation Damage Score

0.9123

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (59/59)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	C	T	11: 9,277,891	L645F	probably benign	Het
Acss3	T	C	10: 106,951,990	Y522C	probably damaging	Het
Asb18	A	G	1: 89,954,462	V118A	possibly damaging	Het
Aste1	T	A	9: 105,397,835	C8S	probably benign	Het
Atp10a	A	G	7: 58,803,675	S834G	probably benign	Het
Cdh18	A	G	15: 23,226,768	D105G	probably damaging	Het
Cenpb	T	C	2: 131,179,014	E288G	probably damaging	Het
Clcnka	C	T	4: 141,389,317	G541D	probably null	Het
Dctn3	T	C	4: 41,716,407	I134V	possibly damaging	Het
Dennd4b	T	C	3: 90,275,626	S917P	probably benign	Het
Fam135b	A	T	15: 71,622,016	D21E	probably damaging	Het
Fam174a	T	C	1: 95,314,247	V144A	probably damaging	Het
Fbxo38	A	G	18: 62,505,971	Y1087H	probably damaging	Het
Gm9271	G	T	7: 39,363,652		noncoding transcript	Het
Grm2	T	C	9: 106,651,076		probably null	Het
Hrasls	A	T	16: 29,220,410	R81*	probably null	Het
Htt	T	A	5: 34,870,806	V1802D	possibly damaging	Het
Ighv1-75	C	A	12: 115,834,254	G16V	probably benign	Het
Krt78	G	A	15: 101,947,609	T589I	probably damaging	Het
Lama3	T	C	18: 12,498,936		probably benign	Het
Lbr	A	T	1: 181,828,902	V227D	probably benign	Het
Lsamp	T	C	16: 42,134,423	V211A	probably damaging	Het
Map3k19	G	A	1: 127,822,966	R883C	probably damaging	Het
March8	A	C	6: 116,403,520	I111L	possibly damaging	Het
Mrps10	T	A	17: 47,378,242	M187K	probably benign	Het
Ncdn	G	A	4: 126,745,047	R660C	probably damaging	Het
Notum	A	T	11: 120,656,345	Y332*	probably null	Het
Nr1h5	A	T	3: 102,947,829	L319I	probably damaging	Het
Olfr1082	T	A	2: 86,594,001	I276L	probably benign	Het
Olfr635	A	T	7: 103,979,714	H180L	possibly damaging	Het
Osbpl5	T	C	7: 143,692,947	D765G	possibly damaging	Het
Parp3	C	T	9: 106,474,505	V170M	possibly damaging	Het
Pcdh15	A	G	10: 74,635,672		probably benign	Het
Pcdha9	T	G	18: 36,998,816	S313A	probably benign	Het
Pfkm	A	G	15: 98,122,226	R201G	possibly damaging	Het
Pgm5	G	A	19: 24,750,401	R375*	probably null	Het
Phactr2	A	G	10: 13,474,065	S72P	possibly damaging	Het
Plec	A	G	15: 76,174,532	L3600P	probably damaging	Het
Pou6f1	G	A	15: 100,585,993	T208M	possibly damaging	Het
Rabep1	C	T	11: 70,917,529	S394L	probably damaging	Het
Ranbp2	T	G	10: 58,465,667	F687C	probably damaging	Het
Ranbp6	A	G	19: 29,812,463	F163S	probably damaging	Het
Rcor3	T	C	1: 192,120,130	N240D	probably benign	Het
Samd13	C	A	3: 146,646,310	K95N	probably benign	Het
Slc25a17	G	T	15: 81,360,774		probably benign	Het
Slfn8	G	T	11: 83,004,721	H420N	probably benign	Het
Sptbn5	G	A	2: 120,046,484		probably benign	Het
Stim2	G	A	5: 54,109,733	E21K	probably damaging	Het
Tmem163	A	G	1: 127,551,330	Y151H	possibly damaging	Het
Trio	A	G	15: 27,902,748	I209T	probably benign	Het
Tubal3	T	A	13: 3,933,432	L404H	probably damaging	Het
Ubqln3	A	G	7: 104,142,433	F150S	probably damaging	Het
Ubr5	T	C	15: 38,030,657	S425G	possibly damaging	Het
Vmn2r52	T	A	7: 10,170,934	H326L	probably damaging	Het

Other mutations in Gm7275

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL01072:Gm7275	APN	16	48074156	exon	noncoding transcript
IGL01603:Gm7275	APN	16	48073579	exon	noncoding transcript
IGL01939:Gm7275	APN	16	48073583	exon	noncoding transcript
IGL02269:Gm7275	APN	16	48073822	exon	noncoding transcript
IGL02403:Gm7275	APN	16	48073628	exon	noncoding transcript
R0332:Gm7275	UTSW	16	48073769	exon	noncoding transcript
R1162:Gm7275	UTSW	16	48074032	exon	noncoding transcript
R1743:Gm7275	UTSW	16	48073757	exon	noncoding transcript
R3087:Gm7275	UTSW	16	48073735	exon	noncoding transcript
R4590:Gm7275	UTSW	16	48073619	exon	noncoding transcript
R5910:Gm7275	UTSW	16	48073463	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- CAAGACACGCAGGAGCATTG -3'
(R):5'- CATTAGAGCATTAGTCCTACATCCC -3'

Sequencing Primer
(F):5'- CATTGAGCTGGACCCTTTGGAG -3'
(R):5'- GCATTAGTCCTACATCCCACATTAGG -3'

Posted On

2016-11-08