Incidental Mutation 'R5617:Pgm5'
ID439613
Institutional Source Beutler Lab
Gene Symbol Pgm5
Ensembl Gene ENSMUSG00000041731
Gene Namephosphoglucomutase 5
Synonyms9530034F03Rik, aciculin
MMRRC Submission 043276-MU
Accession Numbers

Genbank: NM_175013

Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R5617 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location24683016-24861855 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 24750401 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 375 (R375*)
Ref Sequence ENSEMBL: ENSMUSP00000036025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047666]
Predicted Effect probably null
Transcript: ENSMUST00000047666
AA Change: R375*
SMART Domains Protein: ENSMUSP00000036025
Gene: ENSMUSG00000041731
AA Change: R375*

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 19 163 3.9e-31 PFAM
Pfam:PGM_PMM_II 198 306 1.8e-15 PFAM
Pfam:PGM_PMM_III 311 425 6.9e-31 PFAM
SCOP:d3pmga4 427 567 5e-74 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133692
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoglucomutases (EC 5.2.2.2.), such as PGM5, are phosphotransferases involved in interconversion of glucose-1-phosphate and glucose-6-phosphate. PGM activity is essential in formation of carbohydrates from glucose-6-phosphate and in formation of glucose-6-phosphate from galactose and glycogen (Edwards et al., 1995 [PubMed 8586438]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,277,891 L645F probably benign Het
Acss3 T C 10: 106,951,990 Y522C probably damaging Het
Asb18 A G 1: 89,954,462 V118A possibly damaging Het
Aste1 T A 9: 105,397,835 C8S probably benign Het
Atp10a A G 7: 58,803,675 S834G probably benign Het
Cdh18 A G 15: 23,226,768 D105G probably damaging Het
Cenpb T C 2: 131,179,014 E288G probably damaging Het
Clcnka C T 4: 141,389,317 G541D probably null Het
Dctn3 T C 4: 41,716,407 I134V possibly damaging Het
Dennd4b T C 3: 90,275,626 S917P probably benign Het
Fam135b A T 15: 71,622,016 D21E probably damaging Het
Fam174a T C 1: 95,314,247 V144A probably damaging Het
Fbxo38 A G 18: 62,505,971 Y1087H probably damaging Het
Gm7275 A T 16: 48,074,164 noncoding transcript Het
Gm9271 G T 7: 39,363,652 noncoding transcript Het
Grm2 T C 9: 106,651,076 probably null Het
Hrasls A T 16: 29,220,410 R81* probably null Het
Htt T A 5: 34,870,806 V1802D possibly damaging Het
Ighv1-75 C A 12: 115,834,254 G16V probably benign Het
Krt78 G A 15: 101,947,609 T589I probably damaging Het
Lama3 T C 18: 12,498,936 probably benign Het
Lbr A T 1: 181,828,902 V227D probably benign Het
Lsamp T C 16: 42,134,423 V211A probably damaging Het
Map3k19 G A 1: 127,822,966 R883C probably damaging Het
March8 A C 6: 116,403,520 I111L possibly damaging Het
Mrps10 T A 17: 47,378,242 M187K probably benign Het
Ncdn G A 4: 126,745,047 R660C probably damaging Het
Notum A T 11: 120,656,345 Y332* probably null Het
Nr1h5 A T 3: 102,947,829 L319I probably damaging Het
Olfr1082 T A 2: 86,594,001 I276L probably benign Het
Olfr635 A T 7: 103,979,714 H180L possibly damaging Het
Osbpl5 T C 7: 143,692,947 D765G possibly damaging Het
Parp3 C T 9: 106,474,505 V170M possibly damaging Het
Pcdh15 A G 10: 74,635,672 probably benign Het
Pcdha9 T G 18: 36,998,816 S313A probably benign Het
Pfkm A G 15: 98,122,226 R201G possibly damaging Het
Phactr2 A G 10: 13,474,065 S72P possibly damaging Het
Plec A G 15: 76,174,532 L3600P probably damaging Het
Pou6f1 G A 15: 100,585,993 T208M possibly damaging Het
Rabep1 C T 11: 70,917,529 S394L probably damaging Het
Ranbp2 T G 10: 58,465,667 F687C probably damaging Het
Ranbp6 A G 19: 29,812,463 F163S probably damaging Het
Rcor3 T C 1: 192,120,130 N240D probably benign Het
Samd13 C A 3: 146,646,310 K95N probably benign Het
Slc25a17 G T 15: 81,360,774 probably benign Het
Slfn8 G T 11: 83,004,721 H420N probably benign Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Stim2 G A 5: 54,109,733 E21K probably damaging Het
Tmem163 A G 1: 127,551,330 Y151H possibly damaging Het
Trio A G 15: 27,902,748 I209T probably benign Het
Tubal3 T A 13: 3,933,432 L404H probably damaging Het
Ubqln3 A G 7: 104,142,433 F150S probably damaging Het
Ubr5 T C 15: 38,030,657 S425G possibly damaging Het
Vmn2r52 T A 7: 10,170,934 H326L probably damaging Het
Other mutations in Pgm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Pgm5 APN 19 24834766 missense possibly damaging 0.65
IGL01318:Pgm5 APN 19 24816478 missense probably damaging 1.00
IGL01372:Pgm5 APN 19 24733621 missense probably damaging 1.00
IGL01541:Pgm5 APN 19 24816413 missense probably damaging 1.00
IGL01648:Pgm5 APN 19 24824351 missense probably damaging 0.99
IGL02049:Pgm5 APN 19 24824418 missense probably benign 0.00
IGL02827:Pgm5 APN 19 24709295 missense probably benign 0.16
IGL02975:Pgm5 APN 19 24834848 missense probably benign 0.00
3-1:Pgm5 UTSW 19 24727788 missense probably benign 0.02
P0047:Pgm5 UTSW 19 24816421 missense probably damaging 1.00
PIT4466001:Pgm5 UTSW 19 24824329 missense probably damaging 1.00
R0013:Pgm5 UTSW 19 24733540 critical splice donor site probably null
R0047:Pgm5 UTSW 19 24684556 missense probably damaging 0.98
R0180:Pgm5 UTSW 19 24815763 missense probably damaging 1.00
R0317:Pgm5 UTSW 19 24824399 missense possibly damaging 0.55
R0478:Pgm5 UTSW 19 24834869 missense possibly damaging 0.45
R1587:Pgm5 UTSW 19 24815749 missense probably damaging 1.00
R2017:Pgm5 UTSW 19 24824312 missense probably benign 0.06
R2087:Pgm5 UTSW 19 24733563 missense probably damaging 0.99
R2152:Pgm5 UTSW 19 24834815 missense probably damaging 1.00
R2169:Pgm5 UTSW 19 24834815 missense probably damaging 1.00
R3851:Pgm5 UTSW 19 24820203 missense probably damaging 1.00
R4034:Pgm5 UTSW 19 24861657 missense probably damaging 0.96
R4489:Pgm5 UTSW 19 24816445 missense probably benign 0.12
R4630:Pgm5 UTSW 19 24834746 nonsense probably null
R4736:Pgm5 UTSW 19 24834805 missense probably damaging 1.00
R5186:Pgm5 UTSW 19 24820128 missense probably damaging 1.00
R5414:Pgm5 UTSW 19 24709325 missense probably damaging 0.99
R5558:Pgm5 UTSW 19 24824451 splice site probably null
R6142:Pgm5 UTSW 19 24824408 missense probably damaging 1.00
R6648:Pgm5 UTSW 19 24861632 missense probably benign 0.02
R6821:Pgm5 UTSW 19 24861647 missense possibly damaging 0.88
R7360:Pgm5 UTSW 19 24834817 missense probably damaging 1.00
R7421:Pgm5 UTSW 19 24709299 missense probably benign 0.03
R7590:Pgm5 UTSW 19 24709265 missense probably damaging 1.00
R7610:Pgm5 UTSW 19 24834756 missense probably damaging 1.00
R7685:Pgm5 UTSW 19 24727851 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- ATGCATCCTGCTGGCTTTCG -3'
(R):5'- TACGTACTCTCTAACACATGGC -3'

Sequencing Primer
(F):5'- CTGGCTTTCGCTGGTTTTC -3'
(R):5'- AAGGTCCCCGTGTATGA -3'
Posted On2016-11-08