Incidental Mutation 'R5618:Tlr9'
ID 439648
Institutional Source Beutler Lab
Gene Symbol Tlr9
Ensembl Gene ENSMUSG00000045322
Gene Name toll-like receptor 9
Synonyms
MMRRC Submission 043277-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock # R5618 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 106222598-106226883 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106224739 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 410 (I410F)
Ref Sequence ENSEMBL: ENSMUSP00000082207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062241]
AlphaFold Q9EQU3
PDB Structure Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062241
AA Change: I410F

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: I410F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 333 361 8e-6 BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 4e-11 BLAST
Pfam:TIR 870 1029 7.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik G A 5: 107,548,199 W167* probably null Het
Acvr1 C T 2: 58,462,943 R335Q probably damaging Het
Atg7 A G 6: 114,673,699 D67G probably damaging Het
Avil T C 10: 127,010,577 F417S possibly damaging Het
AW551984 A T 9: 39,590,704 L702Q probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Bcl7a A T 5: 123,361,202 N95Y probably damaging Het
Cblb A G 16: 52,152,668 D454G possibly damaging Het
Cc2d2a A T 5: 43,729,907 Q1226H probably benign Het
Cct5 A G 15: 31,598,015 S13P possibly damaging Het
Clca1 C T 3: 145,004,977 E822K probably benign Het
Csgalnact2 A T 6: 118,126,316 D228E probably damaging Het
Defb12 A T 8: 19,114,798 M8K possibly damaging Het
Dysf A G 6: 84,106,824 D736G probably benign Het
Exog G T 9: 119,462,751 D365Y probably damaging Het
Fam222b T G 11: 78,154,240 V81G probably benign Het
Fam69b T C 2: 26,634,875 S96P probably damaging Het
Fbl A G 7: 28,178,986 E301G probably damaging Het
Fez1 A T 9: 36,843,932 N76Y probably damaging Het
Gm13103 A T 4: 143,850,693 E15V possibly damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
H2-Q4 T A 17: 35,379,925 F57Y probably damaging Het
Ift88 T C 14: 57,481,508 I650T possibly damaging Het
Kif1b A T 4: 149,269,889 D231E possibly damaging Het
Lig4 A T 8: 9,972,021 D586E probably benign Het
Mlc1 C A 15: 88,974,566 L126F probably damaging Het
Muc4 A G 16: 32,754,253 T1376A probably benign Het
Ncoa6 A T 2: 155,437,897 D66E possibly damaging Het
Olfr522 A G 7: 140,162,272 V226A probably damaging Het
Olfr907 C T 9: 38,498,740 Q24* probably null Het
Pard6a T C 8: 105,702,914 V168A probably damaging Het
Pmpcb A G 5: 21,742,788 N163S possibly damaging Het
Prdm2 C T 4: 143,133,537 C1061Y probably benign Het
Prkdc A G 16: 15,809,612 Y3378C probably damaging Het
Sema6a A T 18: 47,281,948 V425E probably damaging Het
Sema7a A T 9: 57,960,283 E439D possibly damaging Het
Serpinf1 T A 11: 75,410,184 T402S possibly damaging Het
Sf3a2 T C 10: 80,804,576 probably benign Het
Smchd1 A T 17: 71,455,727 D172E probably damaging Het
Spag5 T G 11: 78,304,080 I71S probably benign Het
Spata31d1d G A 13: 59,726,400 A1107V probably benign Het
Svep1 A C 4: 58,070,537 S2416R probably benign Het
Tbc1d9 A G 8: 83,242,592 Y503C probably damaging Het
Tmem87a C A 2: 120,369,306 L452F probably benign Het
Tmprss11d A T 5: 86,306,295 M217K probably benign Het
Ttc37 T A 13: 76,173,426 S1346T probably benign Het
Vmn2r80 T C 10: 79,148,921 Y36H probably benign Het
Vmn2r87 A T 10: 130,479,948 F83Y probably damaging Het
Vmp1 C T 11: 86,663,562 R75H probably benign Het
Wapl T A 14: 34,691,906 Y242N possibly damaging Het
Zfp473 T A 7: 44,741,732 D6V probably benign Het
Other mutations in Tlr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 1.00
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.90
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 1.00
IGL02851:Tlr9 APN 9 106224730 nonsense probably null
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 1.00
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
cpg7 UTSW 9 106225349 missense probably benign 0.00
Meager UTSW 9 106224139 missense probably damaging 1.00
PIT4498001:Tlr9 UTSW 9 106223522 missense probably benign 0.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.01
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign
R1940:Tlr9 UTSW 9 106224647 missense probably damaging 1.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 critical splice donor site probably null
R6393:Tlr9 UTSW 9 106224937 missense probably damaging 1.00
R6397:Tlr9 UTSW 9 106225106 missense probably damaging 1.00
R6455:Tlr9 UTSW 9 106223999 missense probably damaging 1.00
R7385:Tlr9 UTSW 9 106225264 missense probably damaging 1.00
R7455:Tlr9 UTSW 9 106224530 missense probably benign 0.00
R7561:Tlr9 UTSW 9 106225949 missense probably benign 0.00
R8889:Tlr9 UTSW 9 106222635 start gained probably benign
R8892:Tlr9 UTSW 9 106222635 start gained probably benign
R8926:Tlr9 UTSW 9 106226014 missense probably benign
R9221:Tlr9 UTSW 9 106224773 missense probably damaging 1.00
R9228:Tlr9 UTSW 9 106225553 missense possibly damaging 0.49
Z1176:Tlr9 UTSW 9 106223663 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAAGGTATCCTTTGCCCGC -3'
(R):5'- ACAGGTCCATGGTGAACTTGAAG -3'

Sequencing Primer
(F):5'- CCTCCACCTGGCAAGTTC -3'
(R):5'- CCTGTCCATGAAGTTCTTAGAAGCAG -3'
Posted On 2016-11-08