Incidental Mutation 'R5618:Wapl'
ID439662
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene NameWAPL cohesin release factor
SynonymsA530089A20Rik, Wapal
MMRRC Submission 043277-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5618 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34673928-34747983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34691906 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 242 (Y242N)
Ref Sequence ENSEMBL: ENSMUSP00000130547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048263
AA Change: Y242N

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: Y242N

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090027
AA Change: Y242N

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: Y242N

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111895
Predicted Effect possibly damaging
Transcript: ENSMUST00000169910
AA Change: Y242N

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: Y242N

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik G A 5: 107,548,199 W167* probably null Het
Acvr1 C T 2: 58,462,943 R335Q probably damaging Het
Atg7 A G 6: 114,673,699 D67G probably damaging Het
Avil T C 10: 127,010,577 F417S possibly damaging Het
AW551984 A T 9: 39,590,704 L702Q probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Bcl7a A T 5: 123,361,202 N95Y probably damaging Het
Cblb A G 16: 52,152,668 D454G possibly damaging Het
Cc2d2a A T 5: 43,729,907 Q1226H probably benign Het
Cct5 A G 15: 31,598,015 S13P possibly damaging Het
Clca1 C T 3: 145,004,977 E822K probably benign Het
Csgalnact2 A T 6: 118,126,316 D228E probably damaging Het
Defb12 A T 8: 19,114,798 M8K possibly damaging Het
Dysf A G 6: 84,106,824 D736G probably benign Het
Exog G T 9: 119,462,751 D365Y probably damaging Het
Fam222b T G 11: 78,154,240 V81G probably benign Het
Fam69b T C 2: 26,634,875 S96P probably damaging Het
Fbl A G 7: 28,178,986 E301G probably damaging Het
Fez1 A T 9: 36,843,932 N76Y probably damaging Het
Gm13103 A T 4: 143,850,693 E15V possibly damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
H2-Q4 T A 17: 35,379,925 F57Y probably damaging Het
Ift88 T C 14: 57,481,508 I650T possibly damaging Het
Kif1b A T 4: 149,269,889 D231E possibly damaging Het
Lig4 A T 8: 9,972,021 D586E probably benign Het
Mlc1 C A 15: 88,974,566 L126F probably damaging Het
Muc4 A G 16: 32,754,253 T1376A probably benign Het
Ncoa6 A T 2: 155,437,897 D66E possibly damaging Het
Olfr522 A G 7: 140,162,272 V226A probably damaging Het
Olfr907 C T 9: 38,498,740 Q24* probably null Het
Pard6a T C 8: 105,702,914 V168A probably damaging Het
Pmpcb A G 5: 21,742,788 N163S possibly damaging Het
Prdm2 C T 4: 143,133,537 C1061Y probably benign Het
Prkdc A G 16: 15,809,612 Y3378C probably damaging Het
Sema6a A T 18: 47,281,948 V425E probably damaging Het
Sema7a A T 9: 57,960,283 E439D possibly damaging Het
Serpinf1 T A 11: 75,410,184 T402S possibly damaging Het
Sf3a2 T C 10: 80,804,576 probably benign Het
Smchd1 A T 17: 71,455,727 D172E probably damaging Het
Spag5 T G 11: 78,304,080 I71S probably benign Het
Spata31d1d G A 13: 59,726,400 A1107V probably benign Het
Svep1 A C 4: 58,070,537 S2416R probably benign Het
Tbc1d9 A G 8: 83,242,592 Y503C probably damaging Het
Tlr9 A T 9: 106,224,739 I410F possibly damaging Het
Tmem87a C A 2: 120,369,306 L452F probably benign Het
Tmprss11d A T 5: 86,306,295 M217K probably benign Het
Ttc37 T A 13: 76,173,426 S1346T probably benign Het
Vmn2r80 T C 10: 79,148,921 Y36H probably benign Het
Vmn2r87 A T 10: 130,479,948 F83Y probably damaging Het
Vmp1 C T 11: 86,663,562 R75H probably benign Het
Zfp473 T A 7: 44,741,732 D6V probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
R8038:Wapl UTSW 14 34691682 missense probably benign
R8053:Wapl UTSW 14 34692321 missense probably damaging 1.00
Z1177:Wapl UTSW 14 34745690 makesense probably null
Predicted Primers PCR Primer
(F):5'- ATACTACTGTTCAGATAGCCCTGC -3'
(R):5'- GCTTGGCCTAAGAACACTTTG -3'

Sequencing Primer
(F):5'- GCCCTGCTATTTGTTAATTTGCATAG -3'
(R):5'- GGCCTAAGAACACTTTGTATGATATC -3'
Posted On2016-11-08